-
No products found
because this supplier's products are not listed.
Cristina Godinho-Silva, et al.,
bioRxiv - Immunology 2019
Quote:
... Whole-mount samples were incubated overnight or for 2 days at 4°C using the following antibodies: anti-Tyrosine hydroxylase (TH) (Pel-Freez Biologicals) and anti-GFP (Aves Labs) ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Michelle A. Baird, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured for 7 days in Tu 2% media (1205Lu) supplemented with lipid depleted FBS (Omega Scientific, Fisher Scientific). Dox inducible LBR KD was initiated 3 days prior to the experiment ...
-
No products found
because this supplier's products are not listed.
Hitika Gulabani, et al.,
bioRxiv - Plant Biology 2021
Quote:
... rinsed and incubated overnight at 4°C with indicated primary antibodies [anti-SNC1 (Abiocode; R3588-1), anti-PR1 ...
-
No products found
because this supplier's products are not listed.
Jacqueline Grimm, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Membranes were then incubated overnight at 4 °C with anti-LPS antibody (1:400,000; Hycult Biotech) in milk ...
-
No products found
because this supplier's products are not listed.
Jamilla Akhund-Zade, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
The MA and FL traps were created by cutting an approximately 2 inch-square flap into an empty one-gallon plastic ethanol jug (Koptec, Decon Labs) and baiting them with a fruit and wine mixture ...
-
No products found
because this supplier's products are not listed.
Courtney L. Finch, et al.,
bioRxiv - Microbiology 2020
Quote:
... The Catalyst One analyzer (IDEXX Laboratories) was used for biochemical analyses of serum samples ...
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Aminu S. Jahun, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... C-176 (Focus Biomolecules), or H-151 (Focus Biomolecules ...
-
No products found
because this supplier's products are not listed.
David Z. Bushhouse, Julius B. Lucks,
bioRxiv - Molecular Biology 2022
Quote:
... using EconoSpin® All-in-One mini spin columns (Epoch Life Science). IVT linear template was eluted from spin columns using 50 μL UltraPure™ DNase/RNase-Free Distilled Water (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Zi Ye, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Defibrinated sheep blood was stored at 4°C and used within 2 weeks of purchasing (Hemostat Laboratories, Dixon, CA). Human foot odorants were provided as cloth strips cut from socks that had been continually worn for 5 days by a 30-year-old male volunteer and thereafter incubated overnight at 37°C in a sealed Ziploc plastic bag (SC Johnson ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Paola Bianchimano, et al.,
bioRxiv - Microbiology 2022
Quote:
... cecum was rapidly collected and resuspended in prereduced anaerobically sterilized saline and 100uL of 10−4 through 10−7 dilutions was plated on brucella blood agar (Anaerobe Systems) and incubated in an aerobic incubator ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Primary antibody was applied overnight at 4°C for PDE11A (Fabgennix PD11-101 at 1:500). The following day ...
-
No products found
because this supplier's products are not listed.
Carole Fruchart Gaillard, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cells were incubated for 2h at 37°C with 5 μg/ml DiI-LDL (1,1’-dioctadecyl-3,3,3’,3’-tetramethyl-indocarbocyanine perchlorate, Cedarlane/Kalen Biomedical) in SFM media before fixation ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Simona Pellecchia, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... matched with the ones provided by Cellecta’s whitelist were used ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Yu Zhang, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The pairwise correlations between transcriptomes were calculated by gene expression levels (as estimated by TPM) of 3987 one-to-one orthologs across the 21 species (including the public dataset, Medicago) (Figure S7) ...
-
No products found
because this supplier's products are not listed.
Yulong Li, et al.,
bioRxiv - Genomics 2021
Quote:
... 2% dextrose) at 30°C to an OD600 of ~0.3 and arrested in G1 phase with α-factor (GenWay) at a final concentration of 50 ng/mL for 2 h ...
-
No products found
because this supplier's products are not listed.
Emmeline L. Blanchard, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The RNA was heat denatured at 65°C for 10 minutes before capping with a Cap-1 structure using guanylyl transferase and 2’-O-methyltransferase (Aldevron). mRNA was then purified by lithium chloride precipitation ...
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and heated to 90 °C for 2 min while bubbling with nitrogen gas in N,N-dimethylformamide (DMF, Oakwood Chemical). Fmoc deprotection was carried out with 20% piperidine (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Dhananjay M. Nawandar, et al.,
bioRxiv - Microbiology 2022
Quote:
... One or two drops of 0.5% proparacaine (McKesson Corp.) were applied to the eye ...
-
No products found
because this supplier's products are not listed.
Andre Machado Xavier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using a 7 ml dounce tissue grinder (DWK Life Sciences, 357542) as performed in Gosselin et al ...
-
No products found
because this supplier's products are not listed.
Roie Cohen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Samples were then incubated overnight at 4°C in the appropriate primary antibody diluted in antibody diluent buffer (GBI labs cat: E09-300). Following 3 washes in PBS ...
-
No products found
because this supplier's products are not listed.
Rashmi Chandra, et al.,
bioRxiv - Neuroscience 2023
Quote:
... loaded with one zirconia silica bead (2.3 mm, OPS Diagnostics) per well ...
-
No products found
because this supplier's products are not listed.
Ezekiel C. Thomas, Amber Ismael, Jeffrey K. Moore,
bioRxiv - Cell Biology 2020
Quote:
... and 1% yeast extract) at 30°C then diluted into synthetic media (2% glucose, CSM from Sunrise Science Products, #1001 San Francisco, CA) and grown to log phase at 30°C ...
-
No products found
because this supplier's products are not listed.
Sylwia Machcinska, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and C (CELLnTEC, Switzerland) was added per insert ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
G. Uppal, et al.,
bioRxiv - Biophysics 2020
Quote:
... The PEG-RGD and 4-arm PEG-acrylate (4-PEG-ACR, 20kDa, JenKem Technology) were mixed at a 1.5:8.5 (w/w ...
-
No products found
because this supplier's products are not listed.
Richard J. Marsh, et al.,
bioRxiv - Cell Biology 2021
Quote:
COS-7 cells (CRL-1651, ATCC) cultured on 25-mm-diameter coverslips (CSHP-No1.5-25, Bioscience Tools) were first fixed with 37 °C pre-warmed 3% PFA (15710 ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... MEFs were maintained at 37°C in DMEM (Wisent Bioproducts: 4.5 g/L glucose ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 1x premix 4 to 7.3 ampholyte (Protein Simple) were loaded onto the capillaries ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Gong-Her Wu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Quantifoi®l R 2/2 Micromachined Holey Carbon grid: 200 mesh gold (SPI supplies Cat#:4420G-XA) grids were prepared for cell plating by sterilizing using forceps to carefully submerge them in 100% ethanol (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HCA-7 cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% FBS (Atlas Biologicals F-0500-D) and penicillin-streptomycin (Thermo 15140122) ...
-
Recombinant Antigen
Cat# REC31700-100,
100µg USD $488.0
Ask
Roberta Marzi, et al.,
bioRxiv - Immunology 2022
Quote:
... SARS-CoV-2 S2 (The Native Antigen Company, REC31807-500), S1 (The Native Antigen Company ...