-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Bridget Shafit-Zagardo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Perilipin 2 (PLIN2) antibody recognizes the N-terminal amino acids 1-29 (Progen GP40, 1: 400). APC/CC1 (OP80 Millipore ...
-
No products found
because this supplier's products are not listed.
Bowen Qiu, et al.,
bioRxiv - Pathology 2020
Quote:
... A microsyringe (#7635-01, Hamilton Company, 7 Reno, Nevada) with a 30-gauge needle (#7803-07 ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Tingyu Han, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... (7) added BCP (Molecular Research Center, BP 151, Cincinnati, OH, USA) to the above centrifuge tubes ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC) was purchased from Boston Biochem; human ISG15−7-amino-4-methylcourmarin (ISG15-AMC ...
-
No products found
because this supplier's products are not listed.
Adriana Blazeski, et al.,
bioRxiv - Bioengineering 2023
Quote:
... at passage 7 were maintained in FibroLife S2 Fibroblast Medium (Lifeline Cell Technology) and cultured until 50-70% confluency prior to use in MVNs ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... followed by fixation with a 10% trichloroacetic acid (TCA; Bioshop Canada Inc) at 4°C for one hour ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Sandeep Surendra Panikar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The purified mAbs was then reacted with a 20-fold molar excess of 2-S-(4-Isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid (p-SCN-Bn-NOTA, Macrocyclics) overnight at 4 °C with gentle agitation ...
-
No products found
because this supplier's products are not listed.
Michelle A. Baird, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured for 7 days in Tu 2% media (1205Lu) supplemented with lipid depleted FBS (Omega Scientific, Fisher Scientific). Dox inducible LBR KD was initiated 3 days prior to the experiment ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus alkaline lignin was degraded by microwave solvolysis using a mixture (15 mL) of deuterated acetic acid and D2O (2:1) containing 1 mM TsCl in a microwave reactor (Biotage Initiator Plus) at 160° C for 30 min (Entry 22) ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Shannon E. Paquette, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The digest reaction product was run in a 2% agarose gel containing RedSafe nucleic acid staining solution (Bulldog Bio Inc, Cat. No. 21141). The gel results were visualized using the Bio-Rad Gel Doc XR+.
-
No products found
because this supplier's products are not listed.
Tamjid A Chowdhury, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Naphthaleneacetic acid (K-NAA) (Phytotechnology Laboratories) was dissolved in double distilled water to obtain 250 mM K-NAA solution and filter-sterilized by passing through 25 mm sterile syringe filter (Pall Corporation) ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Heng Lin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... HEK cells were transfected with 2-3 μg of the designated construct or empty vector using the PolyJet (SignaGen Laboratories, SL100688).
-
No products found
because this supplier's products are not listed.
Ellen Busschers, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ascorbic acid free α-MEM (Caisson laboratories) supplemented with 10% FBS (Gibco) ...
-
No products found
because this supplier's products are not listed.
Miloslav Sanda, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Fmoc-amino acids were purchased from ChemPep, Inc ...
-
No products found
because this supplier's products are not listed.
Takuro Shimaya, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The streptavidin decoration of the cellulose membrane (Spectra/Por 7, Repligen, Waltham Massachusetts ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Ludovico Cantuti-Castelvetri, et al.,
bioRxiv - Microbiology 2020
Quote:
... Then lipoic acid-PEG(1k)-NH2 (#PG2-AMLA-1k, Nanocs) was added to a final concentration of 5 µM ...
-
No products found
because this supplier's products are not listed.
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... isolated cells were incubated for 7 days in Teflon bags (VueLife 72C; Cellgenix, Freiburg, Germany) in VLE RPMI 1640 (Biochrome ...
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnology, Cat.#21141). Gel imaging was conducted on a Gel Doc XR+ System (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
K. M. Pruss, et al.,
bioRxiv - Microbiology 2020
Quote:
... Supernatant was filtered and dialyzed against dH2O with 1kD MWCO membranes (Spectra/Por 7, Spectrum Labs)) and subsequently lyophilized ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Xiaoxuan Lin, et al.,
bioRxiv - Biophysics 2023
Quote:
... and hand-packing into a column (2 mm ID × 2 cm, IDEX C-130B). After digestion ...
-
No products found
because this supplier's products are not listed.
Danielle L. Michell, et al.,
bioRxiv - Immunology 2019
Quote:
... total RNA was isolated from ethylenediaminetetraacetic acid (EDTA)-collected plasma using Total RNA Purification Kits (Norgen Biotek). Small RNA (cDNA ...
-
No products found
because this supplier's products are not listed.
Alexis S. Zajicek, et al.,
bioRxiv - Neuroscience 2021
Quote:
... blots were stripped between probes with Membrane Stripping Buffer-3 (Boston BioProducts). Signals were detected using SuperSignal West Femto Maximum Sensitivity Substrate Kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...