-
No products found
because this supplier's products are not listed.
Lukas Weiß, et al.,
bioRxiv - Plant Biology 2021
Quote:
... methanol, 0.5 mg/ml X-gluc (1,5-bromo-4-chloro-3-indoxyl-β-D-glucuronic acid, cyclohexylammonium salt (Carbosynth, Bratislava, Slovak Republic), (Schweizer et al. ...
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ...
-
No products found
because this supplier's products are not listed.
Andrew H. Cooper, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4 µL FastBlue (FB; 2% in sterile PBS; CAS# 73819-41-7; Polysciences Inc., Warrington, PA USA) per paw was then slowly injected ...
-
No products found
because this supplier's products are not listed.
Zhe Zhang, Jay R. Gibson, Kimberly M. Huber,
bioRxiv - Neuroscience 2021
Quote:
... Whole cell recordings of L2/3 and L5 pyramidal neurons were obtained using borosilicate pipettes (4-7 MΩ) and a Multiclamp 700A amplifier (Molecular Devices). Internal solution contained (in mM) ...
-
No products found
because this supplier's products are not listed.
Xavier Grau-Bové, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... followed by another round of centrifugation at 21,000xg 4°C for 1h (Eppendorf, Centrifuge 5424R). Pellets were stored at −70°C ...
-
No products found
because this supplier's products are not listed.
Timothy J. Mottram, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
R. Christopher D. Furniss, et al.,
bioRxiv - Microbiology 2021
Quote:
... the covalent DsbB inhibitor 4,5-dichloro-2-(2-chlorobenzyl)pyridazin-3-one (final concentration of 50 μM) (Enamine) was added to the medium ...
-
Cat# HY-W010130-100 mg,
100 mg, USD $50.0
Ask
LeYuan Gu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 2000 nL of gabazine (2 μg/mL, 4 μg/mL, n = 7, HY-103533, MedChemExpress) was injected into the lateral ventricle cannula or the bilateral cannulas of LC ...
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, Takeshi Noda, Stephan Becker,
bioRxiv - Molecular Biology 2019
Quote:
A total of 2×104 Huh-7 cells were seeded onto a µ-Slide 4 well (Ibidi) and cultivated in DMEM/PS/Q with 10% FBS ...
-
No products found
because this supplier's products are not listed.
JS Cho, et al.,
bioRxiv - Pathology 2024
Quote:
... Isotype controls or fluorescence minus one (FMO) controls were used, and the live/dead marker 7-aminoactinomycin D (7-AAD, PerCP) (Miltenyi Biotec) was added to all samples 10 min before analysis (10 μl to 1 ml of cell suspension).
-
No products found
because this supplier's products are not listed.
A. Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and blocked for 1h at room temperature (RT) or overnight at 4 °C in 5% normal donkey serum (NDS) in PBS-TX (Jackson Immunoresearch). Primary antibodies were chicken anti-GFP (1:1000 ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
6-Chloro-7-hydroxy-4-methylcoumarin is a pharmaceutical intermediate.
Cat# S5760, SKU# S5760-5mg,
5mg, $107.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Bharat Ravi Iyengar, Andreas Wagner,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 6-(2-deoxy-beta-D-ribofuranosyl)-3,4-dihydro-8H-pyrimido-[4,5-C] [1,2]oxazin-7-one triphosphate (dPTP, Trilink Biotechnologies), 200nM each of forward and reverse primers ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Alison Moss, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one of the five tracers was injected into Sprague Dawley rats (3-4 months old, purchased from Envigo) sino-atrial node at the same volume of 10 μL and the heart tissues were harvested in the time window 10 am-12 pm 14 days after injection and stored in OCT immediately ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Yihe Huang, Wei Lü, Juan Du,
bioRxiv - Biophysics 2023
Quote:
... For nanodisc samples, 0.5 mM (1H, 1H, 2H, 2H-Perfluorooctyl)-β-D- Maltopyranoside (FOM, Anatrace) was added for improving particles distribution and contrast ...
-
No products found
because this supplier's products are not listed.
Sabrina Vullo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Oocytes used for VCF experiments were incubated after cRNA injection for 1h in Modified Barth’s Solution (MBS) containing 10 mM 3-maleimidopropionic acid (Bachem) to modify free cysteine residues of proteins natively expressed on the cell membrane ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Chunlei Cang, Boxun Lu, Dejian Ren,
bioRxiv - Physiology 2020
Quote:
... 4 mg collagenase type 2 (Worthington) and 1.5 mg trypsin (Worthington) ...
-
No products found
because this supplier's products are not listed.
Erica A. Birkholz, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4-7 µl of cells were deposited on R2/1 Cu 200 grids (Quantifoil) that had been glow-discharged for 1 min at 0.19 mbar and 20 mA in a PELCO easiGlow device shortly before use ...
-
No products found
because this supplier's products are not listed.
Eugene V. Ravkov, et al.,
bioRxiv - Immunology 2023
Quote:
... SARS-CoV-2 infection was assessed by one or more immunologic (Abbott Architect SARS-CoV-2 IgG ...
-
No products found
because this supplier's products are not listed.
Derek Schaeuble, et al.,
bioRxiv - Neuroscience 2023
Quote:
... tissue was blocked again (4% BSA, 3% donkey serum, 0.1% Triton) for 1 hour before incubation in synaptobrevin-2 primary antibody (Synaptic Systems; 104 211C3) (1:200 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Hailey Axemaker, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The spheroids were grown for 21 days and imaged every 7 days with Cytation 3 Imaging reader (Biotek, Winooski, VT, USA). ImageJ software was used to measure the lengths and areas of the spheroids to compare the formed spheroids over time ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Helmut Bischof, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Glucose uptake was assessed using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2- NBDG) (Biomol GmbH). Therefore ...
-
No products found
because this supplier's products are not listed.
Tulsi Upadhyay, Vaibhav V Karekar, Ishu Saraogi,
bioRxiv - Biochemistry 2020
Quote:
... All GrpE variants were labeled with DACM (N-(7-dimethylamino-4-methylcoumarin-3-yl)maleimide) (AnaSpec) and DnaK was labeled with BODIPY-fluorescein-N-(2-aminoethyl)-maleimide (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Ulrich Hohmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and incubated for 1h at 4 °C before being added to 10 µl magnetic V5 beads (v5tma, Chromotek), pre-equilibrated in buffer K ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Jon Palacios-Filardo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch electrodes (4-7 MΩ resistance) were pulled from borosilicate glass capillaries (Harvard Apparatus) using a PC-87 Micropipette puller (Sutter Instrument) ...
-
No products found
because this supplier's products are not listed.
Heta P. Patel, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and bead beating 7×2 min in a Mini-Beadbeater-96 (Biospec #1001). The lysate was recovered and centrifuged to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Francois Chesnais, et al.,
bioRxiv - Bioengineering 2022
Quote:
... plates up to passage 7 and maintained in Endothelial Growth Medium 2 (EGM2; Promocell). Normal Human Dermal Fibroblasts (NHDF ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
Michael Jakob Pichler, et al.,
bioRxiv - Microbiology 2020
Quote:
... and sonication bath (3×10 sec at 4°C) (Bioruptor, Diagenode). Lysates were centrifuged (14.000x g ...
-
No products found
because this supplier's products are not listed.
Anjali Sengar, et al.,
bioRxiv - Microbiology 2023
Quote:
... The membrane was blocked with 5% BSA in TBS containing 0.1% tween-20 (TBS-T) for 1h at 4 °C before incubating with anti-S2 Spike primary antibody (rabbit polyclonal, Sino Biologicals, Cat#: 40590-T62) at 1:1,000 dilution in TBS-T with 5% BSA for 14-16 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Charline Ogier, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-TIM3 Ab (4 μg/ml, clone RMT-3-23, BioXCell, Lebanon, NH), or 25-hydroxycholesterol (4 μM ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Adrien Birot, et al.,
bioRxiv - Genomics 2021
Quote:
... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
No products found
because this supplier's products are not listed.
Kazuki Moroishi, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1H NMR (JEOL, Tokyo, Japan) (400 MHz ...
-
No products found
because this supplier's products are not listed.
Tori Tonn, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... glass slides (4’’ by 3’’; Ted Pella) and the feature-side of the PDMS slabs were thoroughly cleaned with tape to remove any dust particles ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Emma E. Kovak, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... one 2 microgram portion received 5 units of RNase R (Lucigen, Middleton, WI) and the other an equal volume of nuclease-free water (Thermo Fisher Scientific ...