-
No products found
because this supplier's products are not listed.
Deanna Broadwater, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The fixed cells were stained with 1 µM 2’-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]-2,5’-bi-1H-benzimidazole trihydrochloride trihydrate (Hoechst 33342, Invitrogen) for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Hanna Rulff, et al.,
bioRxiv - Biophysics 2024
Quote:
... which was prepared with 20 mM HEPES-buffer (2-(4-(2-Hydroxyethyl)-1- piperazinyl)-ethansulfonsäure) (Sigma-Aldrich, ≥99.5 %, H3375) as calcium chloride is not soluble in DPBS-buffer ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Chrysa Kapeni, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
No products found
because this supplier's products are not listed.
Ganna Galitska, et al.,
bioRxiv - Microbiology 2023
Quote:
DDD85646/IMP-366(2,6-dichloro-4-[2-(1-piperazinyl)-4-pyridinyl]-N-(1,3,5-trimethyl-1H-pyrazol-4-yl)-benzenesulfonamide) was purchased from Cayman Chemicals and used as an inhibitor of viral assembly at the final concentration of 5 µM ...
-
No products found
because this supplier's products are not listed.
Wyatt E. Lanik, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ...
-
No products found
because this supplier's products are not listed.
Wouter A. G. Beenker, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
No products found
because this supplier's products are not listed.
Shu Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mouse anti PiT-2 B-4 (1:1000; Santa Cruz Biotechnology); rabbit anti-V5 D3H8Q (1:1000 ...
-
No products found
because this supplier's products are not listed.
Elizabeth Min, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Smad 2/3 (1:1000; Cell Signaling; #8685S), P-Smad 1/5/8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
John B. G. Mackey, et al.,
bioRxiv - Immunology 2021
Quote:
... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Lani Archer, et al.,
bioRxiv - Plant Biology 2022
Quote:
X-gluc (5-bromo-4-chloro-3-indolyl-b-D-glucopyranosiduronic acid) (Gold Biotechnology, St ...
-
No products found
because this supplier's products are not listed.
Florence E. McLean, et al.,
bioRxiv - Microbiology 2024
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
No products found
because this supplier's products are not listed.
Yuanyuan Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
No products found
because this supplier's products are not listed.
Michael Chabot, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (VWR, Radnor, PA), NaCl (VWR) ...
-
No products found
because this supplier's products are not listed.
Sandeep Ameta, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... 4-(2-Hydroxyethyl)-1-piperazinepropanesulfonic acid (EPPS) was purchased from Alfa Aesar (Product no. ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 1H, 1H, 2H, 2H-Perfluorohexane-1-ol (4:2-FTOH, CAS 2043-47-2, purity ≥ 97%) were from TCI America (Portland ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
Carmen de Pablo, Sergio Casas-Tintó,
bioRxiv - Cancer Biology 2023
Quote:
... DNA was stained with 2-(4-amidinophenyl)-1H-indole-6-carboxami-Dine (DAPI) at 1 μM in Vectashield mounting media (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Qianqian Gao, et al.,
bioRxiv - Genetics 2019
Quote:
... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
G. Siano, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Ewan Phillip Ramsay, et al.,
bioRxiv - Biochemistry 2020
Quote:
... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Alexander M. Horspool, et al.,
bioRxiv - Microbiology 2021
Quote:
... Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637 ...
-
No products found
because this supplier's products are not listed.
Lulu Huang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... BMP-2/4) (ERB medium)3 or adding 10 ng/ml human IL-22 (Peprotech) in WENRA4 (Wnt/ R-spondin1 ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Analía Lima, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and STD samples were mixed and the rehydration solution (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG Buffer 4-7 [GE Healthcare]) was added before overnight IPG-strips passive rehydration (pH gradient 4-7 ...
-
No products found
because this supplier's products are not listed.
Mukund Madhav, et al.,
bioRxiv - Microbiology 2019
Quote:
... were subcultured at a ratio of 1:2 every 2 - 4 weeks and maintained in 25 cm2 culture flasks (Cellstar; Greiner Bio-One, Monroe NC) at 32°C ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Danny Galleguillos, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-[(1R,2R)-1-(2,3-Dihydrobenzo[b][1,4]dioxin-6-yl)-1-hydroxy-3- (pyrrolidin-1-yl)propan 2-yl] nonanamide (GENZ-123346) was obtained from Toronto Research Chemicals (TRC G363450) and solubilized in DMSO ...
-
No products found
because this supplier's products are not listed.
Paul Renauer, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 4 x 2 mm (Phenomenex). The eluents were A ...
-
No products found
because this supplier's products are not listed.
Jesse E Bucksot, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Four New Zealand white male rabbits (Charles River, 3 to 6 months old, 2 to 4 kg) were housed in a 12:12 h light-dark cycle ...
-
No products found
because this supplier's products are not listed.
John C. Obenauer, et al.,
bioRxiv - Neuroscience 2023
Quote:
The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ...
-
No products found
because this supplier's products are not listed.
Zhihui Liu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... with patch pipettes (2-3 MΩ) pulled from borosilicate pipettes (TW150-4, WPI, USA) using PC-10 puller (Narishige ...
-
No products found
because this supplier's products are not listed.
Zhongyun Xie, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the lysate was made from 1∼2 ml packed worms with 3∼4 ml of 0.5-mm diameter glass beads using FastPrep-24 (MP Biomedicals) in lysis buffer [pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Chengyuan Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples (3 μl) were applied to Quantifoil 2/1 Cu 300 holey-carbon grids (Quantifoil) glow-discharged 60 s using a PELCO glow-discharge system (Ted Pella) ...
-
No products found
because this supplier's products are not listed.
Yu-Chia Chen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples for Immunostaining were fixed in 2% PFA or 4% 1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide (EDAC, Carbosynth, Berkshire, UK). The fixed brains were dissected to enhance antigen presentation and to improve image quality.
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Biren M. Dave, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... differentiating cells were confluent again and split 1:3-1:4 into Step 2 differentiation medium: BrainPhys Neuronal Medium (STEMCELL Technologies, cat# 05790), 1X N2 ...
-
Prepared to contain higher clostripain activity. Suggested for bone, heart, liver, thyroid and...
Cat# LS004174,
100 mg, $42.00
Ask
Chunlei Cang, Boxun Lu, Dejian Ren,
bioRxiv - Physiology 2020
Quote:
... 4 mg collagenase type 2 (Worthington) and 1.5 mg trypsin (Worthington) ...