-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Angelo D’Alessandro, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Lysed RBCs were then mixed 1:1 with Hemoglobind (Biotech Support Group), followed by end over end rotation for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Ortal Iancu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... using combinations of 4 primers for Vγ and 3 primers for Jγ regions in each reaction (IdentiClone™ TCRG Gene Clonality Assay, Invivoscribe, Inc.). TRG clonality was ran and analyzed on 2% agarose gel ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Nanoparticle tracking analysis (NTA): 1 μL A549 EVs (1 mg/ml; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were diluted (1:1000 ...
-
No products found
because this supplier's products are not listed.
Akinobu Senoo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Hit 1 was purchased from Vitas-M Laboratory ...
-
No products found
because this supplier's products are not listed.
Igor P. Oscorbin, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1 mg/mL Proteinase K (SibEnzyme, Russia)) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Tonia K. Tsinman, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Alcian Blue (1%, pH 2.5, Rowley Biochemical) Toluidine Blue (0.025% solution ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Madhur Kalyan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... tb (0.1ml) were inoculated with 1:1 diluted blood (0.9 ml) in 7ml endotoxin free Sterilin Bijou tubes (Dynalab corporation, USA) and cultured for 4 days at 37ºC with slow shaking at 80 rpm.
-
No products found
because this supplier's products are not listed.
Ellen Gingrich, Kendra Case, A. Denise R. Garcia,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-BrdU (1:500, Maine Biotechnology Services), mouse anti-CC1 (1:1k ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1 μl of Taq-plus polymerase (NanoHelix, Korea), and 2.5 μl of 10 μM forward/reverse primer ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... heparan sulfate (1 μg/mL, Galen Laboratory Supplies). The final medium was comprised of basal media containing human TGF-β2 (2 ng/mL ...
-
No products found
because this supplier's products are not listed.
Chuan Liu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... diluted 1:60 or porcine kidney ECM (Xylyx Bio ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
Andrew D. Weems, et al.,
bioRxiv - Cell Biology 2022
Quote:
VitroGel coffins were prepared by embedding MV3 or A375 cells in VitroGel 3D or RGD at 1:1 dilution according to manufacturer’s instructions (TheWell Biosciences, sku # TWG001). Briefly ...
-
No products found
because this supplier's products are not listed.
Taylor Russo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and rabbit polyclonal anti-glycosyslceramide (Glycobiotech #RAS_0010, 1:3,000). Primary antibody was detected with HRP-linked donkey anti–rabbit IgG (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Chloe G Myers, et al.,
bioRxiv - Cell Biology 2024
Quote:
... or IGF-1 (25, 50, 100 nM, GroPep Bioreagents), at different doses for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Susanne Hellmuth, Olaf Stemmann,
bioRxiv - Cell Biology 2024
Quote:
... rabbit anti- histone H2A (1:1,000; 11-7017, Abeomics), rabbit anti-pS10-histone H3 (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Amalia J. Napoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Larvae were mounted in 1% High EEO agarose (Crystalgen) molds [37] ...
-
No products found
because this supplier's products are not listed.
Hasna Maachi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... with 1 % (vol./vol.) human serum albumin (Celprogen, Torrance, CA) for 3 days in the presence of EdU (10 μM ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...
-
No products found
because this supplier's products are not listed.
Junnosuke Nakamura, et al.,
bioRxiv - Physiology 2023
Quote:
... 1 mM DTT) and homogenized by DIGITAL HOMOGENIZER (As One International, Inc.). Lysates were centrifuged at 14,000 rpm for 5 min ...
-
No products found
because this supplier's products are not listed.
Hui-Hsuan Kuo, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 10 μg ml−1 Oryza sativa-derived recombinant human transferrin (Optiferrin, InVitria, 777TRF029-10G,), 14 ng ml−1 sodium selenite (Sigma ...
-
No products found
because this supplier's products are not listed.
Shauni L. Geeraerts, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... washing step and Annexin V (IQ Products IQP-120R, 1:100 in binding buffer) staining for 15 min at RT in the dark ...
-
No products found
because this supplier's products are not listed.
Shouka Parvin Nejad, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Sections were then fixed with 100% ACS grade acetone (Caledon Laboratories, cat #1200-1) for 2 minutes before air drying for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Lukas-Adrian Gurzeler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... eluted with 1 mM sodium citrate pH 6.4 (Gene Link, Cat. No. 40-5014-05) and quantified as mentioned above.
-
Peptide to Exendin 4 (1-8)
Cat# CCP2311,
1 mg USD $125.0, 5 mg USD $313.0, 10 mg USD $469.0
Ask
Huy-Dung Hoang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The following primary antibodies and corresponding dilution were used: 1:500 α-INPP5E (# CPA3073, Cohesion Biosciences), 1:10,000 α-β-actin (#A5441 ...
-
No products found
because this supplier's products are not listed.
Lucas T. Laudermilk, et al.,
bioRxiv - Genetics 2020
Quote:
... Zfp30+/+ and Zfp30-/- mice were sensitized with 10 μg Der p 1 (Indoor Biotechnologies, Charlottesville, VA) administered through intraperitoneal injection (in 100 μl of PBS ...
-
No products found
because this supplier's products are not listed.
Alex Quintero-Yanes, Aurélie Mayard, Régis Hallez,
bioRxiv - Microbiology 2022
Quote:
... Temperature (30 °C) was maintained stable during microscopy analysis using the Tempcontrol 37-analog 1 channel equipment (HemoGenix®) coupled to the Axio Imager Z1 microscope ...
-
No products found
because this supplier's products are not listed.
P. Diep, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and suspected anion elements (S, P, and As) (Inorganic Ventures, #CGS1; High-Purity Standards, #100039-1; Inorganic Ventures, #IV-28) were measured via ICP-OES ...
-
No products found
because this supplier's products are not listed.
Briana Mittleman, et al.,
bioRxiv - Genomics 2019
Quote:
... We diluted all antibodies in a 1:1000 dilution with blocking solution made from dry milk (LabScientific Lot 1267N Cat M0841). We show GAPDH isolated in the cytoplasm and CTD to the chromatin fraction (Supplementary Fig ...
-
No products found
because this supplier's products are not listed.
Devika Prasanth, et al.,
bioRxiv - Biophysics 2019
Quote:
Simulated microgravity conditions were produced using a Rotary Cell Culture System (RCCS™) (Fig. 1) developed at the Johnson Space Center by NASA and made commercially available by Synthecon® Inc (Houston ...
-
No products found
because this supplier's products are not listed.
Pedro Gonzalez-Menendez, et al.,
bioRxiv - Physiology 2022
Quote:
... Surface GLUT1 and SLC7A1 expressions were monitored by binding to their retroviral envelope ligand (RBD) fused to eGFP for GLUT1 (1:25 dilution in 50 µls; Metafora biosystems) or to the RBD-rFc fusion protein for SLC7A1 (1:25 dilution in 50 µl ...
-
No products found
because this supplier's products are not listed.
Gino Del Ferraro, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Neural signals from all channels were simultaneously amplified and digitized at 30 kHz with 16 bits of resolution with the lowest significant bit equal to 1 uV (NSpike, Harvard Instrumentation Lab; unit gain headstage ...
-
No products found
because this supplier's products are not listed.
Ying Zhan, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Acid-terminated PLGA (Mw: 25,000 g mol−1, 50:50 lactic acid:glycolic acid, acid end‐capped, Akina Inc. PolySciTech, West Lafayette, IN) was dissolved with dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Lucas Albrechet-Souza, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The apparatus was thoroughly cleaned between animals with Quatricide® PV in water at a concentration of 1:64 (Pharmacal Research Labs, Waterbury, CT). For each rat ...
-
No products found
because this supplier's products are not listed.
Rani Cathrine. C, Bincy Lukose, P. Rani,
bioRxiv - Neuroscience 2019
Quote:
... PCR was performed and the product was purified from the 1% agarose gel using HiYield™ Gel/PCR DNA Mini Kit (Real Biotech Corporation, Taiwan).
-
No products found
because this supplier's products are not listed.
Erica Misner, Min Zhang, Eva Sapi,
bioRxiv - Microbiology 2022
Quote:
... PCR products were analyzed by standard agarose gel electrophoresis in a 1% gel referenced against a Hi-Lo DNA ladder (Bionexus, Inc., Oakland, CA, USA; BN2050). An infected zebrafish sample which was positive for B ...
-
No products found
because this supplier's products are not listed.
Matthew L. Fabian, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Aliquots of 1 μL of TRV1 and recombinant TRV2 were electroporated into 50 μL tubes of Agrobacterium tumifasciens strain GV3101 cells (Intact Genomics, St. Louis MO, USA) using a Bio-Rad Gene Pulser II and Pulse Controller electroporation system set to 2.2 kV ...