-
No products found
because this supplier's products are not listed.
Hillary A. Wadsworth, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 5-(3-Bromophenyl)-1,3-dihydro-2H-benzofuro[3,2-e]-1,4-diazepin-2-one (5-BDBD) (cat. no. T22518, TargetMol, Wellesley Hills, Massachusetts, USA) were dissolved in stock solutions and then diluted into ACSF at specified concentrations (50 µM IVM ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Souade Ikhlef, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 16:0/16:0-PI(4,5)P2 (1,2-dipalmitoyl-sn-glycero-3-phospho-(1′-myo-inositol-4′,5′-bisphosphate)) were purchased from Echelon Biosciences.
-
No products found
because this supplier's products are not listed.
Jessica C. Orr, et al.,
bioRxiv - Cell Biology 2024
Quote:
... in a 3:1 ratio with 1X penicillin/streptomycin and 5% FBS supplemented with 5 μM Y-27632 (Cambridge Bioscience), 25 ng/mL hydrocortisone (Sigma) ...
-
No products found
because this supplier's products are not listed.
Hui Zhang, et al.,
bioRxiv - Microbiology 2021
Quote:
... HEK293 cells were transiently co-transfected at a ratio of 1:2 (H:L) with PEI (49553-93-7, Polyscience) according to the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Patrick Günther, et al.,
bioRxiv - Immunology 2019
Quote:
Whole blood or buffy coat was diluted in room temperature PBS (1:2 or 1:5, respectively) and layered onto polysuccrose solution (Pancoll; PAN Biotech, Germany) for the enrichment of mononuclear cells by density gradient centrifugation according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Per Niklas Hedde, et al.,
bioRxiv - Microbiology 2020
Quote:
... The microarray slides used consisted of 2 × 8 pads of 7 mm × 7 mm each (Oncyte Avid, Grace Bio-Labs, Bend, OR). In this configuration ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Grace I. Borlee, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 100 nM of 2-chloro-adenosine-5’-O-monophsphate (2-Cl-5’-AMP, Axxora, LLC) for internal standardization ...
-
No products found
because this supplier's products are not listed.
Andrew Barszczyk, et al.,
bioRxiv - Cell Biology 2023
Quote:
... alkaline phosphatase conjugated antibodies were detected colourometrically using BCIP/NBT (nitro-blue tetrazolium and 5- bromo-4-chloro-3’-indolyphosphate) Substrate Solution (#BE116.100ML; Bio Basic Canada Inc). For analysis of bands ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Carlos A. Rodríguez-Salazar, et al.,
bioRxiv - Immunology 2023
Quote:
... an additional wash using NT2 buffer was performed and the beads were incubated with 200 µl of NT2 buffer and treated with 3-[4-(aminosulfonyl) phenyl]propanoic acid (pCEBS) (Enamine US inc.) or 2,5-Dimethyl-4-sulfamoyl furan-3-carboxylic acid (SFC ...
-
No products found
because this supplier's products are not listed.
Daniela Saderi, Brad N. Buran, Stephen V. David,
bioRxiv - Neuroscience 2019
Quote:
... 1 to 4 high-impedance tungsten microelectrodes (FHC or A-M Systems, impedance 1-5 MΩ) were slowly advanced into cortex with independent motorized microdrives (Alpha-Omega) ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Alan Wanke, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and laminaripentaose β-1-3-(Glc)5 at a concentration of 1.5 mg·mL−1 were used as standards (Megazyme, Bray, Ireland). To visualize the glucan fragments ...
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Kaori Matsuyama, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... WT and mutants were purified by using SkillPak TOYOPEARL Phenyl-650M (c.v. = 5 ml, Tosoh, Tokyo, Japan) equilibrated with 20 mM sodium acetate buffer ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... mixed 1:1 with 4 M ammonium sulfate (Teknova) and centrifuged for 10 min. ...
-
No products found
because this supplier's products are not listed.
Hao Yan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 2’,7’-dichlorodihydrofluorescein diacetate (DCFDA, Cell Biolabs) were used for mitochondrial and intracellular ROS staining ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
William Beimers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1-2 mg/mL Zymolyase (AMSBIO, 120493-1)] for lysis at 30°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Sudha Silwal Gautam, et al.,
bioRxiv - Bioengineering 2020
Quote:
... pax 7 (1:1000, rabbit; Lifespan Biosciences, Inc., Seattle, WA, USA), S100 (1:100 ...
-
No products found
because this supplier's products are not listed.
Drew T. Dunham, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 μg of RNA was ran on a 8% polyacrylamide urea gel (National Diagnostics SequaGel 1:4) in 1x TBE buffer (100mM Tris base ...
-
No products found
because this supplier's products are not listed.
Min Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The media were collected from the upper channel at different time points (0 h, 1 h and 2 h) and the fluorescence intensity was measured using microplate system (ABI Vii 7).
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
35 mm glass bottom dish with 4 chambers, 20mm microwell, #1 cover glass (0.13-0.16mm). Designed...
Cat# D35C4-20-1-N,
100/case, $184.00
Ask
Laura R Lee, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 5 mL of 1/2 MS with 2% low melt agarose was cast into imaging cuvettes (CellVis product number #C1-1.5H-N) after being filtered through a 0.45 micron nylon filter to remove any particulates that might disturb the path of the light sheet to prepare media “blankets” ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... KHYG-1 cells was additionally supplemented with 5 ng/mL recombinant human IL-2 (ImmunoTools GmbH, Germany). Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3 ...
-
No products found
because this supplier's products are not listed.
Souradeep Basu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2 μl Detection Buffer 1 (CisBio) was immediately added to the reaction mixture ...
-
Alginate 5% is a viscous alginate hydrogel, suitable for both bioprinting and casting. You can...
Cat# IKA325000503,
5 mL, USD $220.0
Ask
Umar Butt, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Collagen 1 (concentration 5 μg ml−1; PureCol EZ Gel, Advanced BioMatrix) supplemented with Fibronectin (25 μg ml−1 ...
-
No products found
because this supplier's products are not listed.
Chisato Kunitomi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Female mice (3-4 weeks old) were intraperitoneally injected with 5 IU pregnant mare serum gonadotropin (PMSG; MyBioSource, MBS173236) to induce follicle growth ...
-
No products found
because this supplier's products are not listed.
Sumin Jang, Elias Gunmit, Hynek Wichterle,
bioRxiv - Developmental Biology 2022
Quote:
... ISL1/2 (Goat, 1:5000 Neuromics GT15051), MNX1 (Guinea pig ...
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Laura M. Canaday, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-8) (Meso Scale Discovery) and the DIY Human IFN Lambda 1/2/3 (IL-29/28A/28B) ELISA (PBL Assay Science) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Gabriela F. Paredes, et al.,
bioRxiv - Microbiology 2021
Quote:
... and single worms of similar size (1-2 mm length, representing adult L. oneistus) were handpicked by forceps (Dumont 3, Fine Science Tools, Canada) under a dissecting microscope ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Naihua N. Gong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Flies aged 5-7 days were anesthetized on CO2 pads (Genesee Scientific Cat #59-114) and loaded into individual glass tubes (with 5% sucrose and 2% agar ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Ori Maller, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-cytokeratin 5 antibody (Fitzgerald, Cat# 20R-CP003, dilution 1:400), anti-vimentin antibody (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Robin C. Orozco, et al.,
bioRxiv - Immunology 2021
Quote:
... CD4 (PerCP/BV605, Tonbo Bioscience/Biolegend, 1:200, clone RM4-5), CD8a (APC-Cy7/APC-H7/APC ...
-
No products found
because this supplier's products are not listed.
Yoann G. Santin, et al.,
bioRxiv - Microbiology 2023
Quote:
... manually back blotted for 3-4 secondes and flash-frozen in liquid ethane using a CP-3 plunger (Gatan). Data were collected on a 300-kV CRYO ARM™ 300 (JEM-Z300FSC ...
-
No products found
because this supplier's products are not listed.
Ji Wang, et al.,
bioRxiv - Pathology 2021
Quote:
... 5-7 μL were injected and analyzed using a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu ...
-
No products found
because this supplier's products are not listed.
Caterina Di Sano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1% nonessential amino acids and 2□mM L‐glutamine (all from Euroclone) was used for culturing A549 and Colo 699.The cells were maintained in an incubator at 37□°C with a humidified atmosphere with 5% CO2and were maintained as adherent monolayers ...
-
No products found
because this supplier's products are not listed.
Mário Hüttener, et al.,
bioRxiv - Microbiology 2021
Quote:
... 10 g l-1 tryptone and 5 g l-1 yeast extract) with vigorous shaking at 200 rpm (Innova 3100, New Brunswick Scientific). The antibiotics used were chloramphenicol (Cm ...
-
No products found
because this supplier's products are not listed.
Michael D. Grant, et al.,
bioRxiv - Immunology 2023
Quote:
... or entire S2 domain of SARS-CoV-2 Wuhan-Hu-1 S (ACROBiosystems). Beads were resuspended in PBS + 0.05% BSA ...
-
No products found
because this supplier's products are not listed.
Jue Wang, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A sample containing 1-20µg of protein was loaded into a 4-15% precast gel (Bio-Rad Mini-ProTEAN) and run at 60V for 20min followed by 160V for 1 hour ...