-
No products found
because this supplier's products are not listed.
Emily H. Adhikari, et al.,
bioRxiv - Immunology 2023
Quote:
... plates were incubated overnight at 4°C with primary antibody (1:5,000 anti-SARS-CoV-2 alpaca serum) (Capralogics Inc) (126) ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals). Non-phosphorylated Ub protein (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Immunofluorescent staining of either differentiating cells in ALI wells or of the paraffin embedded human bronchus from healthy nonsmokers (Donor 1: Age 27, Female; Donor 2: Age 40, Female and Donor 3: Age 27, Female; catalog number HuFPT111, US Biomax, Inc., Rockville, MD, USA), or mouse trachea (C57BL/6 ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Zelin Liu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... second-strand cDNAs were synthesized using P2-T24 (5’-ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT-3’) by I-5 High-Fidelity DNA polymerase (MCLAB) at 98°C for 2 min ...
-
No products found
because this supplier's products are not listed.
Joseph C. Reynolds, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Membranes were blocked for 1 hour using 5% BSA (Akron Biotech, USA, #AK8905-0100) in tris-buffered saline containing 0.05% Tween-20 (Bio-Rad #161-0781 ...
-
No products found
because this supplier's products are not listed.
Paola Bianchimano, et al.,
bioRxiv - Microbiology 2022
Quote:
... cecum was rapidly collected and resuspended in prereduced anaerobically sterilized saline and 100uL of 10−4 through 10−7 dilutions was plated on brucella blood agar (Anaerobe Systems) and incubated in an aerobic incubator ...
-
PRG-1 (EDTA -dPBS Solution) prepares the cells for PRG-2 (containing Trypsin) processing. Cell...
Cat# 4Z0-610,
100.0 mL, $68.0
Ask
Anna E. Boczula, et al.,
bioRxiv - Microbiology 2021
Quote:
... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells ...
-
No products found
because this supplier's products are not listed.
Mariano R. Rodríguez-Sosa, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Ad-MSC were incubated for 30 min with 1/3 dilution of Propidium Iodide (PI) solution (Cytognos, Spain) in PBS 1X ...
-
No products found
because this supplier's products are not listed.
Yannick O Alexandre, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight at 4°C with 10 μg/ml HSV-1 inactivated Vero cell extract (Advanced Biotechnologies). Unbound protein was washed away (PBS 0.05% Tween20 ...
-
No products found
because this supplier's products are not listed.
Hajar Mikaeili, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 7-10 µm thick) and Human Prostate Frozen Sections (HF-408, 7-10 µm thick) were obtained commercially from Zyagen (www.zyagen.com) via AMS Biotechnology (https://www.amsbio.com ...
-
No products found
because this supplier's products are not listed.
Emanuel Rognoni, et al.,
bioRxiv - Cell Biology 2021
Quote:
... blocked with 5% BSA/PBS (1 h at room temperature) and stained with the indicated primary antibodies and 5 µM B-CHP (BIO300, 3Helix) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Carlos Theodore Huerta, et al.,
bioRxiv - Bioengineering 2024
Quote:
... LacZ/Lentiviral vector plasmid and Luc2/Lentiviral vector plasmid were described previously.5 Human ICAM-1/Lentiviral vector was purchased from GenTarget Inc ...
-
No products found
because this supplier's products are not listed.
Kei Jokura, et al.,
bioRxiv - Neuroscience 2023
Quote:
... COS-7 cells (Angio-proteomie, CAT no. cAP-0203) with a low endogenous level of soluble guanylate cyclase activity were used ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kathleen N. Brown, et al.,
bioRxiv - Pathology 2023
Quote:
... and the cells were resuspended in ~500 μL 1% FBS in PBS and transferred to polystyrene 5 ml flow cytometry tubes (MTC Bio). The samples were placed on ice and protected from light until flow cytometry could be performed ...
-
No products found
because this supplier's products are not listed.
Kevin S. Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 250 μL of wounded cells was ejected from the guillotine device and the outlet tubing using a syringe pump (see details in Section 5.3) into 1 mL of the fixing solution in a 2 mL round-bottomed tube (111568, Globe Scientific) and incubated for 10 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Gabriel Brawerman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... aliquots of the low and high glucose supernatants and the insulin content extracts were collected and spun at 3000g for 5 minutes at 4°C and stored at −20°C or used immediately for mouse or human insulin ELISAs (Mercodia) with appropriate dilutions (1:10-1:50 for supernatants ...
-
No products found
because this supplier's products are not listed.
Albéric A. de Lajarte, et al.,
bioRxiv - Biochemistry 2024
Quote:
... adding a T7 promoter sequence at the forward primer (5′ TAATACGACTCACTATAG 3′) using a 2X PCR PreMix (Syd Labs, Cat. MB067-EQ2N), human cDNA (ZYAGEN ...
-
No products found
because this supplier's products are not listed.
Jini Sugatha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-CD8(153-020,Ancell,IF, 1:500, Live imaging, 1:300), anti-CIMPR (ab124767 ...
-
No products found
because this supplier's products are not listed.
Jutamas Uttagomol, et al.,
bioRxiv - Cell Biology 2019
Quote:
... cells were plated and grown for 1∼2 days on collagen-coated BioFlex 6-well culture plates with flexible silicone elastomer bottoms (BF-3001C, Flexcell® International Corporation). Each plate was placed over the loading station containing 6 planar faced posts ...
-
No products found
because this supplier's products are not listed.
Ezekiel C. Thomas, Amber Ismael, Jeffrey K. Moore,
bioRxiv - Cell Biology 2020
Quote:
... and 1% yeast extract) at 30°C then diluted into synthetic media (2% glucose, CSM from Sunrise Science Products, #1001 San Francisco, CA) and grown to log phase at 30°C ...
-
No products found
because this supplier's products are not listed.
Natasha D. Durham, et al.,
bioRxiv - Microbiology 2019
Quote:
... Probes were diluted 1:1 with D12 buffer (Cat# CBP-5436-25; Scienion AG) and printed at the final concentrations indicated above in triplicate spots from a 384-well source plate (Cat# CPG-5502-1 ...
-
No products found
because this supplier's products are not listed.
Thomas Rowe, et al.,
bioRxiv - Microbiology 2024
Quote:
... 180 uL of HEK-λ cells were added to each well containing twenty uL of sample and to serially 1/2-log diluted (0.1 – 1000 ng/mL) recombinant ferret IFNL3 (Kingfisher Biotech, St. Paul, MN, USA). The plates were incubated for 20Hr at 37°C ...
-
No products found
because this supplier's products are not listed.
Mark E. Corkins, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... then moved to a 1.5ml tube containing 1:1 1xMMR:Optiprep (Cosmo Bio Usa Inc AXS1114542) with a glass pipette ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
No products found
because this supplier's products are not listed.
Kai-Ting Huang, et al.,
bioRxiv - Physiology 2024
Quote:
... IP3R2 (Antibody Research Corporation; 1:1000), IP3R3 (BD Transduction Laboratory ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Kawano, et al.,
bioRxiv - Neuroscience 2019
Quote:
... in two stages and using a vertical pipette puller (PB-7, Narishige International USA). The resistance of the recording electrode was 5-7 MΩ ...
-
No products found
because this supplier's products are not listed.
Surya D. Aggarwal, et al.,
bioRxiv - Microbiology 2019
Quote:
... J774A.1 cells were certified by IDEXX BioAnalytics (Columbia ...
-
No products found
because this supplier's products are not listed.
Suranjana Pal, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mouse anti-RFP (1:200; Allele Biotech, catalog #ABP-MAB-RT008 ...
-
No products found
because this supplier's products are not listed.
Takaya Tominaga, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1 µM rac-GR24 (StrigoLab, Torino, Italy), and extracted samples (20 µl ...
-
No products found
because this supplier's products are not listed.
Gemma L. Pearson, et al.,
bioRxiv - Cell Biology 2022
Quote:
... blocked for 1 h at room temperature with 1 X Blocking One solution (Nacalai USA Inc; San Diego, CA, USA). Sections were then incubated in the following primary antisera overnight at 4°C in 1 X PBS + 1% tween + 20% Blocking One solution ...
-
No products found
because this supplier's products are not listed.
Mariusz Mucha, et al.,
bioRxiv - Neuroscience 2021
Quote:
... rabbit anti-tPA (Molecular Innovations, UK; 1:500), mouse anti-NeuN (Chemicon ...
-
No products found
because this supplier's products are not listed.
Sean K. Wang, Yunlu Xue, Constance L. Cepko,
bioRxiv - Neuroscience 2021
Quote:
... or 1:500 of anti-SIRPα (QED Bioscience) in blocking solution overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Eric E. Gardner, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and Fc receptor blocker reagent (Innovex Biosciences; 1:25). Slides were then briefly washed in TBST and primary antibodies were incubated overnight in blocking buffer at 4C in a humidified chamber ...
-
No products found
because this supplier's products are not listed.
Shayna Seenayah, Nofre Sanchez, Ursula M Paredes,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... The Salivary Cortisol Immunoassay chosen (Assay #1-3002, Salimetrics, USA) has been validated for measuring cortisol in primate hair (Meyer et al. ...
-
No products found
because this supplier's products are not listed.
Stavroula Bitsi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... containing 1 mg/mL collagenase from Clostridium histolyticum (S1745602, Nordmark Biochemicals), dissected ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Kristina Astleford-Hopper, et al.,
bioRxiv - Cell Biology 2022
Quote:
3-month-old femora were isolated and fixed in Z-fix (Anatech LTD) and placed in 10% EDTA (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Shaghayegh Soudi, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... 15 soil variables Supplementary Table 1) were used for the genotype-environment association analysis (GEA). We refer to the climatic ...
-
No products found
because this supplier's products are not listed.
Jonard C. Valdoz, et al.,
bioRxiv - Bioengineering 2022
Quote:
... respectively and strained using a 100 µm cell strainer (15-1100-1, Biologix Research Company, MO, USA) twice ...
-
No products found
because this supplier's products are not listed.
Qian Li, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mM MgCl2) was prepared on a Gradient Station platform (Biocomp Instruments). 450 µl of the lysate was carefully layered on top of the sucrose gradient and centrifuged at 35000 rpm (210000g ...
-
No products found
because this supplier's products are not listed.
Frédérica Schyrr, et al.,
bioRxiv - Cell Biology 2023
Quote:
... split in two 4.25 Gy doses 4 h apart using an RS-2000 X-ray irradiator (RAD SOURCE). Transplanted cells were administered the day following irradiation via tail-vein injection ...