-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
David Veysset, et al.,
bioRxiv - Bioengineering 2021
Quote:
... on top of a 1-inch borosilicate glass substrate (n°2 coverslip, ChemGlass) (Layer 5) ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Marisol Sampedro-Castañeda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti Cav2.3 N-terminus 1:250 (Covalab, custom 1, HEK293 & brain), rabbit anti pS15 Cav2.3 1:500 (Covalab ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolomé Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=3) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Pierre-Louis Hollier, et al.,
bioRxiv - Physiology 2020
Quote:
... or rec N-Shh (Shenandoah biotechnology) diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Kelly A. Curtis, et al.,
bioRxiv - Microbiology 2020
Quote:
... Five HIV-1 seroconversion panels (n=42 specimens) were purchased from Zeptometrix Corp ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Marina Chan, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Recombinant purified N-terminal domain (NTD) of the SARS-CoV-2 was obtained from Leinco Technologies Inc (Cat #S853 ...
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Keith D Runnalls, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Self-adhesive Ag-AgCl electrodes (Blue Sensor N; Ambu, Denmark) were placed approximately 2 cm apart in a bipolar montage over the belly of each muscle ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
Liam Hudson, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Crude material was usually adsorbed on diatomaceous earth (Biotage Isolute HM-N) and subjected to chromatography (dry-loading) ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Matsuda, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Signals were detected by N-Histofine® DAB-3S kit (Nichirei Bioscience Inc.). Details of used antibodies are listed in Extended Data Table 6.
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Following secondary antibodies were used: monoclonal N- and S- specific IgG antibodies (Hytest, rabbit IgG ...
-
No products found
because this supplier's products are not listed.
Daisuke Ogasawara, et al.,
bioRxiv - Biochemistry 2024
Quote:
... N-term strep-His tag was first inserted into phCMV3 vector (Genlantis, cat # P003300) using Q5® Site-Directed Mutagenesis Kit (New England BioLabs ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Luca M. Zaeck, et al.,
bioRxiv - Microbiology 2020
Quote:
... Nasal conchae were furthermore decalcified for 4-7 days in Formical-2000™ (Statlab, USA). Samples were trimmed to the sizes and volumes described above ...
-
No products found
because this supplier's products are not listed.
Gabriella T. Heller, et al.,
bioRxiv - Biophysics 2020
Quote:
... recombinant Aβ42 peptide (the 42-residue variant lacking the N-terminal M, see ‘Preparation of recombinant Aβ peptides’) was purchased from rPeptide and prepared following the manufacturer’s instructions ...
-
Cat# FN10100,
100µL, USD $145.00/100µL
Ask
Amanda K. Hund, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 3) 10ul of Alum (2% Alumax Phosphate, OZ Bioscience) + 10ul PBS (alum treatment) ...
-
No products found
because this supplier's products are not listed.
Lili Qin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... DCs were collected and cocultured with autologous CD8+ T cells with the ratio between 1:4 to 1:10 in AIM-V medium with 5% autologous serum and 30 ng/ml IL-21 (Cellgenix, Germany). Two days later ...
-
No products found
because this supplier's products are not listed.
Estifanos N. Habtemichael, et al.,
bioRxiv - Physiology 2019
Quote:
... 100 μl of resuspended cells and 2-4 μg of desired plasmid DNA in 5 μL of volume were pipetted into electroporation cuvettes (2 mm gap, Bulldog Bio 12358-346) and electroporated using a NEPA21 electroporation system ...
-
No products found
because this supplier's products are not listed.
Apirat Chaikuad, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the 5 uL reaction was performed with 4 ug/mL recombinant human ULK2 protein (1-478, SignalChem #U02-11G) and 80 ug/mL MBP in the presence of 25 uM ATP ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The active glucagon-like peptide-1 (7-36) Amide (GLP-1) assay (Cat.# 80-GLP1A-CH01, ALPCO) had an analytical sensitivity of 0.15 pM in a standard range of 0.45-152 pM and inter- and intra-assay CV of 11.6 and 9.5% ...
-
No products found
because this supplier's products are not listed.
Michelle A. Baird, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured for 7 days in Tu 2% media (1205Lu) supplemented with lipid depleted FBS (Omega Scientific, Fisher Scientific). Dox inducible LBR KD was initiated 3 days prior to the experiment ...
-
No products found
because this supplier's products are not listed.
Jiangtao Liang, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 5–7-day-old adult females were blood-fed using artificial blood feeders with defibrinated sheep’s blood (HemoStat Laboratories Inc., CA, USA). Egg dishes were placed in cages for oviposition approximately two to three days after blood feeding.
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 400μM 3-isobutyl-1-methylxanthine (IBMX; 2885842; BioGems) for two days then replaced by a supporting medium (SM) ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Mads Kuhlmann Andersen, et al.,
bioRxiv - Physiology 2022
Quote:
... 5 μL of crude homogenate and protein standards (0 to 2 mg mL-1 bovine serum albumin, ALB001.25, Bioshop Canada, Burlington, ON, CA) was loaded into wells in triplicate followed by 250 μL of Bradford reagent (B6916 ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Siranush Babakhanova, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Two-photon spectrum and cross sections of TagRFP658 were measured in PBS buffer at concentrations ∼1–5·10−5 M in 1 mm glass spectroscopy cuvettes (Starna cells) using an MOM two-photon fluorescent microscope (Sutter Instrument ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Christopher Kesten, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The homogenates were centrifuged at room temperature (10,000 x g for 5 min) and 20 µl of the supernatant were loaded onto 4-12% (w/v) acrylamide gradient gels (Expedeon, GB). SDS-PAGE and protein transfer to nitrocellulose membranes were performed with a Trans-Blot Turbo Transfer System (BioRad ...
-
No products found
because this supplier's products are not listed.
Alina Guna, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the cells were transferred to 1-2 L roller bottles (Celltreat, USA) and grown in a shaking incubator operating at 8% CO2 and rotating at 125 rpm ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The RNA pellet was washed with 75% ethanol followed by spin at 7,500 x g for 5 min at 4 °C and dissolved in 30 µl DEPC-treated water (IBI Scientific, Cat. No. IB42210). Protein extraction ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Kate M. MacDonald, et al.,
bioRxiv - Cell Biology 2022
Quote:
MCF10A cells were cultured in 1:1 mixture of F12:DMEM media supplemented with 5% horse serum (Wisent Bioproducts cat #098150), 20 ng/ml human EGF (Cedarlane Labs cat #AF-100-15) ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...