-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
AL Seufert, et al.,
bioRxiv - Immunology 2022
Quote:
... 2% endotoxin- and fatty acid-free bovine serum albumin (BSA; Proliant Biologicals) and 10% M-CSF ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
A Prabhakar, et al.,
bioRxiv - Immunology 2021
Quote:
... 2-3 ml blood was collected in RNAgard blood tubes (Biomatrica, USA) and stored in −80°C until RNA precipitation ...
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jiling Feng, Yuexun Tang, Wenwei Fu, Hongxi Xu,
bioRxiv - Cell Biology 2023
Quote:
... RT-PCR was performed with a one-step real time PCR using KAPA SYBR FAST One-Step qRT-PCR Universal (D-MARK Biosciences). Primers were used as previously described [18] ...
-
No products found
because this supplier's products are not listed.
Vivian Tam, et al.,
bioRxiv - Systems Biology 2020
Quote:
... (McGill University) and one aged (59M) from Articular Engineering, LLC (IL ...
-
No products found
because this supplier's products are not listed.
Anuj kumar Murmu, et al.,
bioRxiv - Genomics 2022
Quote:
The predicted peptide sequence of Mucin 2 of indigenous duck was derived by Edit sequence (Lasergene Software, DNASTAR) and then aligned with the peptide of other chicken breed and avian species using Megalign sequence Programme of Lasergene Software ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Sarah Howald, et al.,
bioRxiv - Physiology 2021
Quote:
... The magnetic stirrers were connected to one stirrer controller (Rank Brothers Ltd., Cambridge, England). The chamber was closed with a custom-made glass lid with three metal ports ...
-
No products found
because this supplier's products are not listed.
Candice B. Herber, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 4’-trihydroxychalcone were obtained from INDOFINE Chemical Company (Hillsborough ...
-
No products found
because this supplier's products are not listed.
Hayden A. M. Hatch, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The dSO vial was immediately cleared and placed in one arm of a T-maze (CelExplorer Labs) and an empty vial in another ...
-
No products found
because this supplier's products are not listed.
Josée Perreault, et al.,
bioRxiv - Immunology 2020
Quote:
... The plates were incubated once again for one hour at RT followed by washing and addition of 100 μl of 3,3’,5,5’-Tetramethylbenzidine (TMB, ESBE Scientific). The colorimetric reaction proceeded for 20 minutes at RT and was stopped by addition of 100 μl of H2SO4 1N (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Nejla Ozirmak Lermi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
DNA methylation analysis of the MLH1 gene was performed on DNA from frozen tissue samples of 7 tumors and 3 normal tissue (duodenum and blood) samples using a targeted NGS assay (EpigenDx, Hopkinton, MA). In brief ...
-
No products found
because this supplier's products are not listed.
Bettina M. Fuglerud, et al.,
bioRxiv - Genomics 2021
Quote:
... at 4 °C overnight in CHAPS immunoprecipitation buffer (Fivephoton Biochemicals). After washing in TBST ...
-
No products found
because this supplier's products are not listed.
Krystal Courtney D. Belmonte, et al.,
bioRxiv - Neuroscience 2021
Quote:
... brains were removed after 4 mo of CCH (or sham surgery) and post-fixed in Z-Fix (Anatech Limited, Battle Creek, MI, USA) for 24 h at 4°C before cryoprotection in 30% sucrose ...
-
No products found
because this supplier's products are not listed.
Rebecca Guth-Metzler, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1 µL of each reverse transcription was combined with 1 µL GenefloTM 625 size standard ROX ladder (CHIMERx) and 20 µL HiDi (Applied Biosystems) ...
-
No products found
because this supplier's products are not listed.
Florencia Rammauro, et al.,
bioRxiv - Microbiology 2024
Quote:
... Cells were further incubated 1 h at RT with monoclonal antibodies anti-p24 (BLV3, 1/200, VMRD, USA). After three washes with PBS ...
-
No products found
because this supplier's products are not listed.
Takaya Tominaga, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1 µM rac-GR24 (StrigoLab, Torino, Italy), and extracted samples (20 µl ...
-
No products found
because this supplier's products are not listed.
Peng V. Wu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK19 (rabbit, 1:100, Abbomax 602-670), Ki-67 (rat ...
-
No products found
because this supplier's products are not listed.
Ming Yang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-total Rac1 (1:10; NewEast Biosciences); mouse anti-CD44 (1:100 ...
-
No products found
because this supplier's products are not listed.
Jana Key, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... HSPA9 (Oxford Biomedical Research, GR 02, 1:1000), TRAP1 (Abcam ...
-
No products found
because this supplier's products are not listed.
Radoslaw P. Kozak, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Jack bean α-(1-2,3,6)-Mannosidase (JBAM, QA-Bio); (iii ...
-
No products found
because this supplier's products are not listed.
Eric E. Gardner, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and Fc receptor blocker reagent (Innovex Biosciences; 1:25). Slides were then briefly washed in TBST and primary antibodies were incubated overnight in blocking buffer at 4C in a humidified chamber ...
-
No products found
because this supplier's products are not listed.
Jill V. Hagey, et al.,
bioRxiv - Microbiology 2021
Quote:
... and energy content (Cumberland Valley Analytical Services, Hagerstown, MD; Table 1).
-
No products found
because this supplier's products are not listed.
Gurman Kaur, et al.,
bioRxiv - Immunology 2021
Quote:
... and 2.8 µl of 1 M Trehalose (Life Sciences Advanced Technologies), followed by incubation at 72°C for 3 min and placing on ice ...
-
No products found
because this supplier's products are not listed.
Laura-Marie A. Zimmermann, et al.,
bioRxiv - Biochemistry 2022
Quote:
... anti-tropoelastin (#PR385, Elastin Products Company, Owensville, MO, USA; IF:1:200), anti-MMP-13 (#ab39012 ...
-
No products found
because this supplier's products are not listed.
Paul Batty, et al.,
bioRxiv - Cell Biology 2023
Quote:
... NIPBL was detected using a rat monoclonal antibody (Absea, 010702F01, 1:500). Sororin was detected using a custom rabbit antibody (1:500) ...
-
No products found
because this supplier's products are not listed.
Dorothy Y. Zhao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and digested overnight at 37 °C with 1 µg Lys-C (Labchem-wako) and 2µg trypsin (Promega) ...
-
No products found
because this supplier's products are not listed.
Scott Birks, et al.,
bioRxiv - Bioengineering 2023
Quote:
... prior to being tagged with a rabbit anti-nesprin2 antibody (1:300; ImmuQuest IQ565). After primary antibody tagging ...
-
No products found
because this supplier's products are not listed.
Myriam Ruault, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Cleared lysate was incubated overnight with 1 μL of polyclonal antibody anti-Sir3 (Agro-bio). 50 μL of magnetic beads protein A (NEB ...
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and immunostained with the following antibodies: mouse anti-HCV NS4A (Genotype 1B, 1:100, Virogen), rabbit anti-HA (1:100 ...
-
No products found
because this supplier's products are not listed.
Maria Georgiou, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and cultured in mTeSR-1 medium supplemented with 10 uM ROCK inhibitor Y-27632 (Chemdea, CD0141) to form Embryonic Bodies ...
-
No products found
because this supplier's products are not listed.
Wenfeng Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... 5×104 BMDCs were pulsed with 1 mg/ml endotoxin-free chicken egg ovalbumin (OVA, Hyglos GmbH, Germany) in the presence of 50 μg/ml MC38 TEVs or MLC-V ...
-
No products found
because this supplier's products are not listed.
Emanuel Rognoni, et al.,
bioRxiv - Cell Biology 2021
Quote:
... blocked with 5% BSA/PBS (1 h at room temperature) and stained with the indicated primary antibodies and 5 µM B-CHP (BIO300, 3Helix) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Jin-Ran Chen, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Serum bone resorption marker C-terminal telopeptides of type I collagen (CTX-1) was measured by Rat-LapsTM ELISA from Nordic Biosciences Diagnostic (Herlev ...
-
No products found
because this supplier's products are not listed.
Joshua G. Liang, et al.,
bioRxiv - Immunology 2020
Quote:
Endo180-Fc expression vector was generated by subcloning a PCR amplified cDNA encoding soluble human Endo180 (amino acid residue 1-1394) (19) into the HindIII site of pGH-hFc expression vector (GenHunter Corporation) to allow in-frame fusion to human IgG Fc ...
-
No products found
because this supplier's products are not listed.
Kathleen N. Brown, et al.,
bioRxiv - Pathology 2023
Quote:
... and the cells were resuspended in ~500 μL 1% FBS in PBS and transferred to polystyrene 5 ml flow cytometry tubes (MTC Bio). The samples were placed on ice and protected from light until flow cytometry could be performed ...