-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Gwen R. Buel, et al.,
bioRxiv - Biophysics 2022
Quote:
... and incubated with 2 mM DSP (ChemScene CS-0068460 ...
-
No products found
because this supplier's products are not listed.
Bukola Adeoye, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plasma levels of Herpes simplex virus 1/2 (HSV-1/2) and Clostridium tetani (tetanus)-toxoid-specific IgG were captured and measured with ELISA kits from Calbiotech and Alpha diagnostics according to manufacturers’ protocols.
-
No products found
because this supplier's products are not listed.
Juan Feng, et al.,
bioRxiv - Immunology 2021
Quote:
Heavy and light chain V region cDNA sequences of mAbs 2/6.14 and 2/1.12 were determined by Syd Labs (Natick, MA). The mAbs each have γ1 heavy and κ light chains and unique V regions as shown by BLAST searches ...
-
No products found
because this supplier's products are not listed.
Cassandra M. Stawicki, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Aliquots of 2-5 µl of sample were added to 700 µl of 2% PBS and loaded into a cuvette (BrandTech Scientific, 759150). Zeta potential was measured in Folded Capillary Cell cuvettes (Malvern ...
-
Cat# H7V280-500,
USD $1150.0/500.0µg
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Cian Schmitt-Ulms, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Cypridina Luciferase Assay reagent (Targeting Systems, VLAR-2) respectively ...
-
No products found
because this supplier's products are not listed.
Abdugaffor Ablazov, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Approximately 20 mg of lyophilized rice samples were extracted twice with 2 mL of ethyl acetate containing 2 ng of D3-zaxinone (customized synthesis; Buchem B.V., Apeldoorn, The Netherlands). After that ...
-
No products found
because this supplier's products are not listed.
Clémence Boutry, et al.,
bioRxiv - Microbiology 2022
Quote:
... and on 2 June (only ‘Otava’, ‘Rajika’, ‘Rubinola’, and ‘Boskoop’). Trees with spore traps were excluded from receiving fungicide treatments in 2019 and 2020 ...
-
No products found
because this supplier's products are not listed.
Andrew Chase, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Rabbit anti-FLAG (Signalway Antibody LLC, Maryland, USA; T503-2), tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners, Georgia and Crystal Chem, Elk Grove Village, IL, respectively).
-
No products found
because this supplier's products are not listed.
Satsuki Tsuji, Naoki Shibata,
bioRxiv - Molecular Biology 2024
Quote:
... 2 μm (Track-Etched Membrane PCTE filter; GVS Japan, Tokyo, Japan), and 0.7 μm (GF/F glass-fiber filter ...
-
Cat# AB-311,
100 micrograms,USD $565.0
Ask
Savannah Barnett, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Hcrt-SAP (hypocretin-2-saporin, Advanced Targeting Systems, San Diego, CA, USA). The method of stereotaxic injection was similar to those described in our previous study and will be brief here (Nattie et al. ...
-
No products found
because this supplier's products are not listed.
Marko Roblek, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and LPA-FITC were from EY laboratories (FITC-labeled lectin kit #2), anti-β1 integrin (clone HMb1-1 ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Alden M. Shoup, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the probe shank was submerged in freshly made 2% Tergazyme (Alconox Inc.) dissolved in deionized (DI ...
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Xingyu Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2.5:0.1,2.5:0.5, 2.5:1, and 2.5:2, 1.5 MDa sodium hyaluronate from Lifecore Biomedical). The gel solutions were incubated at 37°C overnight and were then submerged in deionized water at room temperature ...
-
No products found
because this supplier's products are not listed.
Aleksei Kuznetsov, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and SARS-CoV-2 Spike protein S1 (Icosagen OÜ, Estonia, cat# P-305-100) were used in this study.
-
No products found
because this supplier's products are not listed.
Bruno Rafael Barboza, et al.,
bioRxiv - Microbiology 2023
Quote:
... and incubated with primary antibodies: mouse anti-cardiac troponin T (HyTest clone 4T19/2) and rabbit anti-α-actinin (Millipore ...
-
No products found
because this supplier's products are not listed.
Chandrashekhar D. Borkar, et al.,
bioRxiv - Neuroscience 2023
Quote:
... retrogradely transported beads (0.2 μl, 1:2 diluted with saline, Lumafluor Inc., Durham, NC) were stereotaxically injected into the respective brain regions ...
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2-axis computer-controlled stepping motor system (4”× 3” XY; Prior Scientific, Jena, Germany), focus encoder (Heidenhain ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Alexander Lercher, et al.,
bioRxiv - Immunology 2023
Quote:
Anesthetized mice were intranasally (i.n.) treated with 2×25 µL clodronate liposomes (Liposoma #C-005) 3 days prior to alveolar macrophage transfer ...
-
No products found
because this supplier's products are not listed.
Eugene Kim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and for acute phase protein α-2-macroglobulin using an ELISA kit (Life Diagnostics Inc., West Chester, USA).
-
No products found
because this supplier's products are not listed.
Takao Fujisawa, et al.,
bioRxiv - Cell Biology 2023
Quote:
Recombinant proteins or ZnCl2 solution for normalization was incubated with 10 µM ZnAF-2 (Goryo Chemical, SK2001-01) in TBS for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Unekwu M. Yakubu, Kevin A. Morano,
bioRxiv - Biochemistry 2021
Quote:
α-synuclein thioflavin T binding assays were performed by incubating 2 μM α-synuclein monomer (StressMarq Biosciences, Victoria, BC, Canada), 1 μM pre-formed fibrils (StressMarq Biosciences ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Eric Esposito, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The RNA was further purified by twice mixing the aqueous supernatant with 700 μL of acidic phenol chloroform and centrifuging the solution in a 5Prime Phase Lock Gel Heavy 2 ml tube (Andwin Scientific) at 16,000 rcf to separate the phases ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Natalie C. Butterfield, et al.,
bioRxiv - Genetics 2019
Quote:
... harboring alanine/alanine or threonine/threonine polymorphisms for the deiodinase 2 gene at codon 92 (Dio2Ala92, n=9 and Dio2Thr92, n=10) were generated by Applied Stemcell Inc ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... sections were pre-incubated in 4% PFA (in 0.1 M PB) for ≥2 days at 4°C before processing with the FD NeuroSilver™ kit II (FD Neurotechnologies, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Raphael Lutz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... in fresh human BM samples was performed according to the highly standardized flow cytometry approach developed and described by the Spanish Myeloma Collaborative Group using a commercially available EuroFlow 8-color 2-tube MM MRD Kit (Cytognos, Salamanca, Spain) [38] ...
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from each cornea were seeded equally across 2 wells of a 24-well plate coated with fibronectin collagen (FNC) coating mix (Athena Enzyme Systems) in M5 stabilization media (human endothelial SFM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Jordina Rincon-Torroella, et al.,
bioRxiv - Cancer Biology 2023
Quote:
MIA PaCa-2 or Panc 02.13 cells were transduced with a CMV-Firefly luciferase lentivirus carrying a puromycin-selectable marker (Cellomics Tech; Halethorpe, MD, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...