-
No products found
because this supplier's products are not listed.
Gaudeline Rémillard-Labrosse, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... γH2AX (Trevigen, 1:800). Alexa-labeled secondary antibodies (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Christopher J. DiRusso, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A 0.4 M solution of 2-(7-aza-1Hbenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) (Chem-Impex International) was prepared in DMF and 2.5 ml was used to dissolve 1 mmol of each Nα Fmoc-protected aa (Chem-Impex International) ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... were inoculated separately with a starting OD600= 0.1 or in different ratios (1:1 and 1:10) in Delft medium + 2% beechwood glucuronoxylan (Megazyme, Ireland) for 120 h at RT ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
Arun Sharma, et al.,
bioRxiv - Cell Biology 2020
Quote:
... SARS-CoV-2 double stranded RNA (1:100, J2 clone; Absolute Antibody Inc.); cleaved caspase-3 (1:200 ...
-
No products found
because this supplier's products are not listed.
Jinyong Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... RCaMP1b images were acquired using 561 nm excitation laser and 2 detectors (1 PMT for the pattern and 1 GaAsP detector for RCaMP ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and chicken anti-microtubule associated protein 2 (MAP2, 1:500, EnCor Biotechnology Inc, FL, USA), followed by an incubation (3 days ...
-
No products found
because this supplier's products are not listed.
Xiao He, Yunlu Kang, Lei Chen,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM EGTA and 1 mM PMSF) with a disperser (IKA T18 digital ULTRA-TURRAX). The crude lysis was ultracentrifugated at 35 ...
-
No products found
because this supplier's products are not listed.
Nanami Kikuchi, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... and 2 µl of 1% w/v amine polystyrene fluorescent yellow particles (NH2-beads, Spherotech, Inc) or carboxyl polystyrene fluorescent yellow particles (Spherotech ...
-
No products found
because this supplier's products are not listed.
James R. Occean, et al.,
bioRxiv - Genomics 2023
Quote:
... The sections were blocked for 1 h at room temperature with 2% normal goat serum (Vector Biolabs) then incubated with 2 µg/mL dilution 5hmC antibody (Active Motif ...
-
No products found
because this supplier's products are not listed.
Tiago Monteiro, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Custom Thermoelectrics) and 1-mm thick probes insulated with 2-mm wide polyimide tubing (95820-13, Cole-Parmer). This was used in tandem with a peristaltic pump (200-SMA-150-050 ...
-
No products found
because this supplier's products are not listed.
Jeremy F Brooks, et al.,
bioRxiv - Immunology 2020
Quote:
Immunogens were admixed 1:1 with Alhydrogel 1% adjuvant (Accurate Chemical and Scientific Corp.) and injected i.p ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Vignesh Jayarajan, et al.,
bioRxiv - Cell Biology 2022
Quote:
The ROCKi inhibitor Y-27632 ((R)-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide-2) was purchased from AdooQ Bioscience (#A1101 ...
-
No products found
because this supplier's products are not listed.
Antonin Weckel, et al.,
bioRxiv - Microbiology 2019
Quote:
... AMP concentrations were analyzed in the same supernatants by ELISA with the following kits: LL37 (Hycult,biotech), human beta defensin 1 (R&D, Novus) and human beta defensin 2 (Elabscience). The concentrations are reported as pg/mL medium ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and mCherry (ThermoFisher #PA534974 at 1:1000; Invitrogen #M11217 at 1:500; PhosphoSolutions #1203-mCherry at 1:10,000). Multiple PDE11A antibodies were utilized to discern the ectopic accumulation of PDE11A4 in ghost axons ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Saikat Bhattacharya, et al.,
bioRxiv - Biochemistry 2021
Quote:
... SETD2 (Abclonal A3194, dilution 1:6000 and Aviva OAEB00589, dilution 1:3000), HA (Sigma 04-902 ...
-
LC Laboratories' Product Number F-4660 - Fasudil, Monohydrochloride Salt (Eril, HA1077, AT-877,...
Cat# F-4660, SKU# F-4660_500mg,
500 mg, $46.00
Ask
Nguyen Duy Vuong, et al.,
bioRxiv - Microbiology 2019
Quote:
... 200 µl of sample were prepared: 10,000 spores were resuspended in 198 µL of malt 1 % and 2 µL of rapamycin (LC laboratories, R-5000) were added for treatment or 2 µl of DMSO as mock for control ...
-
No products found
because this supplier's products are not listed.
Alyssa Huff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... while injections of CTb 1% (low salt, 1%, List Biological Laboratories, Campbell, CA) in distilled water ...
-
No products found
because this supplier's products are not listed.
Nihal Karakaş, et al.,
bioRxiv - Immunology 2023
Quote:
... ß-actin (1: 5000, Abbkine), α-tubulin (1 ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...
-
Cat# H7A318-1,
USD $335.0/ml
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and 2-amino-N-(1-phenylethyl)benzamide (Enamine).
-
No products found
because this supplier's products are not listed.
Chetan Kumar Arya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Wizard Classic 1 and 2 (Rigaku Japan). Crystals of DMFase were obtained by mixing 200 nl of protein in buffer A with equal volumes of precipitant ...
-
No products found
because this supplier's products are not listed.
Amy Cheung, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Membranes were incubated with primary antibodies prepared in 1% skim milk and 1% Bovine Serum Albumin in TBST for 2 hours (mouse anti-SERT 1:7000, MAb Technologies, ST51-2 ...
-
No products found
because this supplier's products are not listed.
Yan Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at ∼1×105 cells per well in 100 µL of a 1:2 mixture of NbActiv4 (BrainBits) and plating medium (28 mM glucose ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Michelle A. Baird, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured for 7 days in Tu 2% media (1205Lu) supplemented with lipid depleted FBS (Omega Scientific, Fisher Scientific). Dox inducible LBR KD was initiated 3 days prior to the experiment ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Irini Topalidou, et al.,
bioRxiv - Cell Biology 2019
Quote:
Approximately 1-2 × 105 cells per well were plated onto cover slips (Thomas Scientific #121N79) placed in 24-well cell culture plates ...
-
No products found
because this supplier's products are not listed.
Jenny Vo, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cells are lysed in a 2ml Eppendorf tube containing 1mL 0.5mm zirconia beads by vortexing for six cycles of 1 minute vortexing with 1 minute pauses using the Turbomix attachment on a Vortex Genie 2 (Scientific Industries Inc SKU: SI-0564) that had been pre-run at max speed for 1 minute preceding the vortexing to ensure consistent machine performance in the cold ...
-
No products found
because this supplier's products are not listed.
Iliodora V. Pop, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mice (1-2 months old) were injected with 4% (w/v) FG solution in saline (Fluorochrome). Mice were anesthetized with isoflurane and the area above and around the cerebellar region was prepared for surgery ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 7% fat (w/v) (MD, Bio-Serv); or diets containing 10% (w/v ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Andrea Scelfo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... cells were blocked for 1h in 2% BSA in 0.1% Tween-20 in PBS and then incubated anti-5MC antibody (1:500; A-1014 Epigentek) in 0.1% Tween-20 in PBS overnight at 4°C and subsequently after washing with 1:500 anti-mouse Cy5-conjugated in 0.1% Tween-20 in PBS for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Najet Serradj, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The double layer of dorsal musculature was closed with 7-0 vicryl absorbable surgical suture (Ethicon) and skin closed with 7 mm surgical wound clips (Fine Science Tools). Mice were given 1 ml saline (0.9% solution ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... COVID-19 convalescent plasma was diluted (1:10) and incubated with recombinant SARS-CoV-2 full-length Spike (BPS Bioscience) for 1 h at 37 °C prior to adding to an hACE2 pre-coated ELISA plates ...
-
No products found
because this supplier's products are not listed.
Rebecca A. Callahan, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 100 Hz pulse trains (1 ms pulse width) at 2-5 V (A-M systems Isolated Pulse Stimulator Model 2100). Confocal imaging was performed as described above ...
-
No products found
because this supplier's products are not listed.
Rodrigo Dutra Nunes, Daniela Drummond-Barbosa,
bioRxiv - Physiology 2023
Quote:
... 1 (Spectrum Chemicals), respectively ...
-
No products found
because this supplier's products are not listed.
Nicholas H Harbin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... sections were rinsed in TBS-gelatin and incubated for 2 hours with secondary goat anti-rabbit Fab fragments conjugated to 1.4-nm gold particles (1:100; Nanoprobes, Yaphank, NY) and 1% dry milk in TBS-gelatin to limit cross-reactivity of the secondary antibody ...
-
No products found
because this supplier's products are not listed.
Matthew D. Lauver, et al.,
bioRxiv - Immunology 2022
Quote:
... Virus dilutions were combined 1:1 with 0.45% sheep erythrocytes (Innovative Research) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Shahzad S. Khan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the other group (7 mice) received untreated diet (Research Diets D01060501) for 14 days and served as the control group ...
-
No products found
because this supplier's products are not listed.
Wenwei Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-luciferin potassium salt (Prolume). The neutralization half-maximal inhibitory dilution (IC50 ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... rabbit anti-β-gal (1:200, ICL), rat anti-Elav (1:100 ...
-
No products found
because this supplier's products are not listed.
Adam S Hassan, et al.,
bioRxiv - Immunology 2019
Quote:
... 1 mM L-glutamine (all from Wisent Bioproducts), 0.05 mM 2-mercaptoethanol (Sigma-Aldrich) ...