-
No products found
because this supplier's products are not listed.
Shilpi Chandra, et al.,
bioRxiv - Immunology 2021
Quote:
... cells were incubated in glucose-free media containing 5 μg/ml 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher) and 2.5% FBS at 37 °C ...
-
No products found
because this supplier's products are not listed.
Goki Tsujimoto, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Dimethyl 2-oxoglutarate (5 mM; Sigma, 349631), and 3-Mercaptopicolinic Acid (5 mM ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Nicolas Snaidero, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 2% aqueous uranyl acetate (EMS) was applied overnight at 4°C and subsequently warmed to 50°C for 2 h ...
-
No products found
because this supplier's products are not listed.
Enrico Capobianco, et al.,
bioRxiv - Cancer Biology 2023
Quote:
NMDI-14 inhibitor (Ethyl 2-(((6,7-dimethyl-3-oxo-1,2,3,4-tetrahydro-2-quinoxalinyl)acetyl)amino)-4,5-dimethyl-3-thiophenecarboxylate) was purchased from Calbiochem (Cat. Nr. 530838) and reconstituted in DMSO (10mg/ml ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Luiza Filipis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 4-(2,1,3-Benzoxadiazol-4-yl)-1,4-dihydro-2,6-dimethyl-3,5-pyridinecarboxylic acid methyl 1-methylethyl ester (isradipine or isr) (HelloBio) was initially dissolved at 20 mM in DMSO and then diluted in external solution 20 μM just before use ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Marco R. Rink, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
No products found
because this supplier's products are not listed.
Felix J. Flomm, et al.,
bioRxiv - Microbiology 2022
Quote:
... staining with 2% uranyl acetate (Merck KGaA) overnight in water ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Eirik S. Nilssen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and dimethyl sulfoxide (2%; DMSO; VWR Chemicals) without prior dehydration ...
-
No products found
because this supplier's products are not listed.
Abhishek Jamwal, et al.,
bioRxiv - Microbiology 2023
Quote:
... IL-2 and IL-7 (Biolegend) were added at 10 ng/ml final concentration ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Shuai A. Huang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... BCL-2 (Clone#7/BCL-2, BD Bioscience), MCL-1 (Cat#600-401-394 ...
-
No products found
because this supplier's products are not listed.
Kai Dünser, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) from Biotium (CA, USA), Wortmannin (WM ...
-
No products found
because this supplier's products are not listed.
Pierre-Louis Hollier, et al.,
bioRxiv - Neuroscience 2020
Quote:
... non-essential amino acids 2 % (Lonza, Bäle, Switzerland), FGF 1 ng/mL (PeproTech ...
-
No products found
because this supplier's products are not listed.
Nozomu Matsumoto, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and fibroblast growth factor 2 (FGF-2, 5 ng mL-1; PeproTech). Cells were passaged before reaching 90% confluency and the medium was changed every 2–3 days.
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Xiyu Dong, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
No products found
because this supplier's products are not listed.
Jianjian Zhao, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... EA (ethyl acetate, 2×10-3 in dilution, Alfa Aesar) and IA (isoamyl acetate ...
-
No products found
because this supplier's products are not listed.
John B. G. Mackey, et al.,
bioRxiv - Immunology 2021
Quote:
... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Keisuke Fujita, et al.,
bioRxiv - Biophysics 2019
Quote:
... Cy3 labeled 2’/3’-O-(2-aminoethyl-carbamoyl)-adenosine-5’-triphosphate (Jena Bioscience) was added into the imaging buffer instead of ATP.
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Josep Fita-Torró, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The ribosomal inhibitor (2-(2-Bromophenyl)-2,3-dihydro-1H-naphtho[1,8-de][1,3,2]diazaborine (DAB) was purchased from TCI Europe and applied to yeast cultures at a final concentration of 20μg/ml from a 20mg/ml stock in ethanol ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Sebastian Tacke, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... plain grids (Quantifoil 2/2) were transferred to the microscope ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Ludek Eyer, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2’-C-methyladenosine and 7-deaza-2’-C-methyladenosine were from Carbosynth (Compton, UK). For in vitro studies ...
-
No products found
because this supplier's products are not listed.
Ryo Okuda, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
Michael Dolan, et al.,
bioRxiv - Genetics 2022
Quote:
... 2-amino-3-methylimidazo [4,5-f] quinoline (IQ) was purchased from Toronto Research Chemicals. Methanol was purchased from Sigma ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
Cat# HY-W002820-10 mM * 1 mL,
10 mM * 1 mL, USD $55.0
Ask
Irina V. Mikheyeva, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were stained with 300 µM 3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl)carbonyl]amino]-D-alanine hydrocholoride (HADA, MedChemExpress, Cat. #HY-131045/CS-0124027) and perfused with 0.85X PBS prior to the osmotic shock.
-
No products found
because this supplier's products are not listed.
Abhichart Krissanaprasit, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2’-Fluoro-2’-deoxycytidine-5’-Triphosphate (2’F-dCTP) and 2’-Fluoro-2’-deoxyuridine-5’-Triphosphate (2’F-dUTP) were purchased from Trilink Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Karen. M. Marshall, et al.,
bioRxiv - Bioengineering 2023
Quote:
... the scaffolds seeded with C2C12 cells were moved to a 24 well plate and 1.5 mL of media was added (basal with 2% FCS ± 5 µg of BMP-2 (3.33 µg/mL BMP-2). Culture was continued for 4 days and ALP staining performed on the 5th day from cell seeding ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Ludovic Enkler, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2% (w/v) glucose and mixtures of amino acids (MP Biomedicals) depending on the auxotrophies used for selection ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Arman Izadi, et al.,
bioRxiv - Immunology 2023
Quote:
... 2 µL of sodium acetate (3M, pH 5.0) was added to the wells to observe a right shift in the APC channel ...
-
No products found
because this supplier's products are not listed.
Shuting Cao, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... the dried pellet was dissolved in 550 µl D2O containing 0.01 mg/ml Sodium 2,2-Dimethyl-2-Silapentane-5-Sulfonate (DSS; Cambridge Isotope). The samples were then vortexed and centrifuged at 16000 rpm for 12 min ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
The ROS production by macrophages was measured by chemiluminescence in the presence of 5-amino-2,3-dihydro-1,4-phthalazinedione (luminol) using a thermostatically (37°C) controlled for 1 hr (Envision, PerkinElmer). For nitrite release ...
-
No products found
because this supplier's products are not listed.
Sophia Michelchen, Burkhard Micheel, Katja Hanack,
bioRxiv - Immunology 2020
Quote:
... 2 ng/ml interleukin 7 (IL7) (Miltenyi Biotec, Bergisch-Gladbach, Germany) and/or 1 μg/ml lipopolysaccharide (LPS ...
-
No products found
because this supplier's products are not listed.
Celia Barrio-Alonso, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... for 5-7 days and embedded into 2 mg/ml collagen type-I (StemCell Technologies, Vancouver, Canada) gels ...