-
No products found
because this supplier's products are not listed.
Ortal Iancu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... using combinations of 4 primers for Vγ and 3 primers for Jγ regions in each reaction (IdentiClone™ TCRG Gene Clonality Assay, Invivoscribe, Inc.). TRG clonality was ran and analyzed on 2% agarose gel ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Kuppusamy Balamurugan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... SUM149 and IBC-3 cells with Dox-inducible shRNA expression were first infected with CMV-Luciferase-2A-GFP (Neo) (GenTarget Inc, Cat# LVP403) virus and selected as per instructions ...
-
No products found
because this supplier's products are not listed.
Alyssa R. Phillips, et al.,
bioRxiv - Plant Biology 2023
Quote:
... About 1 mm of the tip (meristem and root cap) was excised and transferred to a tube containing 20 µL of 3% cellulase R-10 (Desert Biologicals, Phoenix, AZ) and 1.25% pectolyase Y-23 (Desert Biologicals ...
-
No products found
because this supplier's products are not listed.
Julia Hansen, et al.,
bioRxiv - Microbiology 2022
Quote:
... ethyl-[R]-cysteinyl-[S]-lysyl-[S]-lysyl-[S]-lysyl-[S]-lysyl-[S]-lysine(ε-aminocaproyl-∈-aminocaproyl-biotinyl) x 3 CF3COOH (EMC Microcollections, Tübingen, Germany) at 1.5 mg/ml in carbonate buffer (pH 9.2 ...
-
Carbohydrate
Cat# GMS0070S,
Inquiry
Ask
Christopher J. Minteer, et al.,
bioRxiv - Cancer Biology 2022
Quote:
3 primary human astrocyte cell lines were derived from the cerebral cortex of one 21-year-old male donor (Creative Biolabs, #NCL-2103-P104). The 21M donor was split into Astro1 ...
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
Jinchang Zhu, Yi He, Yong Wang, Li-Heng Cai,
bioRxiv - Bioengineering 2023
Quote:
... 4.3 mmol), and hydrazine (13.8 mL, 430.0 mmol) are added to a 60 mL high pressure tube (ACE GLASS, Sigma-Aldrich, Cat. No. Z568872). The tube is sealed ...
-
No products found
because this supplier's products are not listed.
Anuj kumar Murmu, et al.,
bioRxiv - Genomics 2022
Quote:
The predicted peptide sequence of Mucin 2 of indigenous duck was derived by Edit sequence (Lasergene Software, DNASTAR) and then aligned with the peptide of other chicken breed and avian species using Megalign sequence Programme of Lasergene Software ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Takao Fujisawa, et al.,
bioRxiv - Cell Biology 2023
Quote:
Recombinant proteins or ZnCl2 solution for normalization was incubated with 10 µM ZnAF-2 (Goryo Chemical, SK2001-01) in TBS for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Unekwu M. Yakubu, Kevin A. Morano,
bioRxiv - Biochemistry 2021
Quote:
α-synuclein thioflavin T binding assays were performed by incubating 2 μM α-synuclein monomer (StressMarq Biosciences, Victoria, BC, Canada), 1 μM pre-formed fibrils (StressMarq Biosciences ...
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... approximately 2×107 fungal cells were incubated with human kininogen (10 μg/ml; Molecular Innovations, Inc., Cat. # HK-TC) and/or human vitronectin (30 μg/ml ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Lina Sui, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Perifusate samples were collected at the outlet at flow rate of 200 μl/min and every 2 min samples were used to determine insulin concentration by Mercodia Ultrasensitive Human Insulin ELISA kit.
-
No products found
because this supplier's products are not listed.
Emily H. Adhikari, et al.,
bioRxiv - Immunology 2023
Quote:
... plates were incubated overnight at 4°C with primary antibody (1:5,000 anti-SARS-CoV-2 alpaca serum) (Capralogics Inc) (126) ...
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... whole blood (10 µL) was mixed with 2 mM EDTA (10 µL) and analyzed using the HemaVet 950S (Drew Scientific).
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Eric Esposito, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The RNA was further purified by twice mixing the aqueous supernatant with 700 μL of acidic phenol chloroform and centrifuging the solution in a 5Prime Phase Lock Gel Heavy 2 ml tube (Andwin Scientific) at 16,000 rcf to separate the phases ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Hongbing She, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR was performed in a total reaction volume of 10 μL containing 5 μL 2×Taq Master Mix (CoWin Biosciences, China), 0.25 μL forward and reverse primer ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Hiroki Miyahara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and stained with 4ʹ ,6-diamidino-2-phenylindole (DAPI) for 10 min prior to mounting in FluoromountTM (K024, Diagnostic BioSystems, California, USA). Samples for ThT staining were treated with 1% ThT for 3 min and differentiated in 1% acetic acid for 15 min ...
-
No products found
because this supplier's products are not listed.
Victoria E. Brings, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... the surface of the right hind paw was sterilized and a 5-mm incision was made through the skin starting 2 mm from the heel using a type 11 scalpel blade (McKesson, Richmond, VA). The flexor digitorum brevis muscle was pulled up to isolate ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Jonathan M Budzik, et al.,
bioRxiv - Microbiology 2019
Quote:
Immunostaining for LC3 was performed with blocking and permeabilization buffer (0.3% Triton X-100, 2% bovine serum albumin) and anti-LC3 (clone 2G6, Nanotools #0260-100/LC3-2G6) at a dilution of 1:200 for 3 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Jordina Rincon-Torroella, et al.,
bioRxiv - Cancer Biology 2023
Quote:
MIA PaCa-2 or Panc 02.13 cells were transduced with a CMV-Firefly luciferase lentivirus carrying a puromycin-selectable marker (Cellomics Tech; Halethorpe, MD, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... day 0 and day 21) with 5 μg/dose of recombinant SARS-CoV-2 Spike protein (S1+S2 extracellular domain) (Bon Opus Biosciences, #BP040) adjuvanted with 100 μg/dose alhydrogel adjuvant 2% (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Gaurang Patel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... followed by 20 minutes of boiling at 90°C in Pretreat 2-target retrieval buffer treatment (ACD, 320043) in Oster Steamer (IHC World, LLC, Model 5709) and 30 minutes of Pretreat 3-using protease plus treatment (ACD ...
-
No products found
because this supplier's products are not listed.
Pranjali Beri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The uncured LSR was vulcanized at 150°C for 2 minutes using a hydraulic lab press equipped with heated platens (Carver Bench Top Auto Press) then demolded from the tool.
-
No products found
because this supplier's products are not listed.
Nada Sallam, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... or weighed frozen (hippocampus or adipose tissue) and placed into glass tubes with 2 mL acetonitrile and 100 μL deuterated internal standard (Cerilliant, Round Rock, TX, USA). Hippocampal or adipose samples were first homogenised with a glass rod ...
-
No products found
because this supplier's products are not listed.
Ken Shirato, Jun Takanari, Takako Kizaki,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... the cells were co-treated with the indicated concentrations of ETAS®50 or dextrin and 100 ng/mL of SARS-CoV-2 spike recombinant protein S1 subunit (Arigo Biolaboratories, Hsinchu City, Taiwan) for 1 to 24 h ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...