-
No products found
because this supplier's products are not listed.
Megan Chamberland, Brian Farrell, Johannes Yeh,
bioRxiv - Cell Biology 2022
Quote:
... 2 μm carboxylic acid functionalized silica spheres (Bangs Laboratory) were functionalized with octadecylamine (Sigma ...
-
No products found
because this supplier's products are not listed.
Ruchira Mukherji, et al.,
bioRxiv - Microbiology 2019
Quote:
... as well as a Kinetex Phenyl-hexyl column (50 × 2.1 mm, 1.7 µm, 100 Å, Phenomenex, for phenazine-1-carboxylic acid). Elution gradient ...
-
No products found
because this supplier's products are not listed.
Huiwang Zhan, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 400mM 3-Bromopyruvic acid (BioVision, #B1045), 20 mM MitoTracker (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... Mice (CD-1 strain, female, purchased from Envigo, 6-7 weeks old, 25–28 g, n=3) were anesthetized with isoflurane (3–4% ...
-
No products found
because this supplier's products are not listed.
Nicholas de Mojana di Cologna, et al.,
bioRxiv - Microbiology 2022
Quote:
... Wells were washed twice with PBS and stained biofilms were resuspended in 7% acetic acid (v/v) and absorbance was read at 595 nm in a Synergy H1 hybrid multimode reader (BioTek).
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... pH 7 (Polysciences) to transfect 293Freestyle cells ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Joke De Jaeger-Braet, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the slides were washed in cold 3:1 ethanol:acetic acid and mounted in Vectashield medium with DAPI (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Katrine Wacenius Skov Alanin, et al.,
bioRxiv - Microbiology 2021
Quote:
... 7) DC3000 − A (Illumina only), 8 ...
-
No products found
because this supplier's products are not listed.
Taiki Satoh, et al.,
bioRxiv - Immunology 2021
Quote:
... 10 ng/ml IL-7 (Miltenyi Biotec), 2 mM L-Glutamine ...
-
No products found
because this supplier's products are not listed.
Nina Sillner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Cholic acid 7-sulfate (CA-S) and 3’-sialyllactose were purchased from Cayman (Biomol GmbH, Hamburg, Germany). Sulfate (S ...
-
No products found
because this supplier's products are not listed.
Noel M. Lacerna II, et al.,
bioRxiv - Microbiology 2020
Quote:
... (±) trans-12,13-Epoxy-octadecanoic acid (6) and 12(Z)-octadecenoic acid (7) were purchased from Larodan Fine Chemicals (Solna ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 7: 3-methyl-L-histidine (NmH2, Chem-Impex International); 8 ...
-
No products found
because this supplier's products are not listed.
J Muir, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-(2-carboxypiperazin-4-yl) propyl-1phosphonic acid (CPP, 10 mM; HelloBio). Inhibitory postsynaptic currents (IPSCs ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Sonja Giger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or 7-Amino-Actinomycin D (7-AAD, Beckman Coulter, B88526) was added to the cell suspensions ...
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Ana Lucia Rosales Rosas, et al.,
bioRxiv - Molecular Biology 2022
Quote:
7-Deaza-2’-C-Methyladenosine (7-DMA) was purchased from Carbosynth (Berkshire, UK) and dissolved in DMSO ...
-
No products found
because this supplier's products are not listed.
Alexis S. Bailey, Margaret T. Fuller,
bioRxiv - Developmental Biology 2023
Quote:
... TSA plus cyanine 3 solution (dilute TSA-Cy3 1:250 in 100mM Boric Acid, pH8.5 containing 0.003% H2O2) (Akoya Biosciences) was added to the tissue sections and incubated for 10 min at RT ...
-
No products found
because this supplier's products are not listed.
Mathilde Ambrosino, et al.,
bioRxiv - Bioengineering 2023
Quote:
The size and shape of the microgels were observed under light microscopy over time (immediately after microencapsulation, then 1, 3, 7, and 14 days) using confocal microscopy Nikon A1RSi (Nikon Champigny sur Marne). The microgels were immersed in complete cell culture medium and stored at 37°C ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...
-
No products found
because this supplier's products are not listed.
Madeleine Linneberg-Agerholm, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and FCS Express 7 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... phenazine-1-carboxylic acid (PCA, Ark Pharm); phenazine-1-carboxamide (PCN ...
-
No products found
because this supplier's products are not listed.
Claire V. Mulholland, et al.,
bioRxiv - Microbiology 2023
Quote:
Mtb cultures were grown to early log phase and then diluted to OD600 0.3 in 10 ml 7H9/OADC/glycerol/tyloxapol and labelled with propionic acid [1-14C] sodium salt (7 μCi) (American Radiolabeled Chemicals, Inc.). Cultures were incubated with shaking at 37 °C for two days and then spun down ...
-
No products found
because this supplier's products are not listed.
Hua Lu, Mark A. Lehrman, Julie K. Pfeiffer,
bioRxiv - Microbiology 2019
Quote:
... and oligosaccharides were labeled with 7-amino-1,3-naphthalenedisulfonic acid (81529, AnaSpec) prior to electrophoresis on 20% acrylamide gels ...
-
No products found
because this supplier's products are not listed.
Kacey Mersch, et al.,
bioRxiv - Biophysics 2020
Quote:
... 20 mM 3-(N-morpholino)propanesulfonic acid (MOPS, RPI), 5 mM DM ...
-
No products found
because this supplier's products are not listed.
Oksana Tsyklauri, et al.,
bioRxiv - Genetics 2020
Quote:
4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
No products found
because this supplier's products are not listed.
Marie-Laure Fogeron, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM amino acid mixture (average concentration of each amino acid 0.3 mM) and 0.1% (w/v) MNG-3 (Maltose Neopentyl Glycol-3, Anatrace). The feeding buffer contained 1x SUB-AMIX buffer (CellFree Sciences Japan) ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... 7) We verified the presence of high molecular weight DNA products in the samples before purifying nucleic acids by Zymo DNA Clean & Concentrator-5 (ZYMO Research).
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Samantha R. Weaver, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... PTH(7-34) (Bachem), or vehicle (0.1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Tomasz Czerniak, James P Saenz,
bioRxiv - Biochemistry 2021
Quote:
... 7-deaza-GTP (Trilink Biotechnologies, USA) was used ...
-
No products found
because this supplier's products are not listed.
Sharon Khuzwayo, et al.,
bioRxiv - Immunology 2020
Quote:
... The following morning plates were washed with 1x PBS-T before being coated with 3 μg/mL streptavidin-ALP secondary antibody (Mabtech, clone 7-B6-1) and incubated for 2 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Michael D. Roberts, et al.,
bioRxiv - Physiology 2023
Quote:
Peptides obtained from each of the five NP mixtures were separately reconstituted according in a solution of 0.1% formic acid and 3% acetonitrile (34) spiked with 5 fmol μL PepCalMix from SCIEX (Framingham, MA, USA). Reconstitution volumes varied by NP types to allow for constant peptide quantity for MS injection between samples regardless of starting volume (240 ng ...
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...
-
No products found
because this supplier's products are not listed.
Ryszard S. Gomolka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked with 7% normal donkey serum (Jackson Immunoresearch) in PBS with 0.03% Triton-X-100 ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Shail Kabrawala, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Actin (2µM; 7% pyrene-labeled) was then polymerized in the presence of 20nM bovine Arp2/3 complex (Cytoskeleton Inc.) plus MBP-tagged fusion proteins in control buffer supplemented with 0.2mM ATP and 0.5mM DTT ...
-
7-(Diethylamino)-coumarin-3-carboxylic acid (7-DCCA) has been used as a laser dye, fluorescent...
Cat# S5308, SKU# S5308-25mg,
25mg, $97.00
Ask
Jeanne Corriveau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... HUVECs were serum starved in M199 media with 0.5% FBS for 3 h followed by a 7 h treatment with 1 μM group I PAK inhibitor FRAX1036 (Selleck Chemicals).
-
(+)-JQ1 derivative
Sold for research purposes only.
Cat# 3822.0, SKU# 3822-10 mg,
10mg, US $121.00 / EA, EURO, €110 / EA
Ask
Anne Margriet Heijink, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 7 nM talazoparib (Axon Medchem), 50 nM mitomycin C (Sigma) ...
-
No products found
because this supplier's products are not listed.
Andrea R. Dos Santos, et al.,
bioRxiv - Microbiology 2022
Quote:
... Citric acid kit: Citric Acid Assay Kit (Megazyme, product Code: K-CITR). Phosphate kit ...
-
No products found
because this supplier's products are not listed.
Dalia E. Gaddis, et al.,
bioRxiv - Immunology 2019
Quote:
... Nrp1 (clone N43-7; MBL International, Woburn, MA), and CD45.1 (clone A20 ...
-
No products found
because this supplier's products are not listed.
Daniel A Chaves, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Tobacco Acid Pyrophosphatase (Epicentre, discontinued) or recombinant PIR-1 was used to dephosphorylate ppp-RNAs for cloning ppp-RNAs when needed while no such treatment was required for cloning p-RNAs ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Paloma García Casas, et al.,
bioRxiv - Cell Biology 2023
Quote:
COS-7 cells were seeded on µ-Dish 35 mm (Ibidi), co-transfected 24 h later with plasmids encoding ER-Mit RspA-splitFAST and either ER-StayGold ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)