-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Vignesh Jayarajan, et al.,
bioRxiv - Cell Biology 2022
Quote:
The ROCKi inhibitor Y-27632 ((R)-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide-2) was purchased from AdooQ Bioscience (#A1101 ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 4 µg Cx36 and 4 µg V5-dGBP-TurboID using 50 µl Geneporter 2 (Genlantis). 24 h after transfection HEK293T cells were treated with 50 µM Biotin in 10% DMEM for 3 h to induce biotinylation of proximal proteins ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
Cat# 886364-26-7,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Nicholas Dillon, et al.,
bioRxiv - Microbiology 2020
Quote:
... hexakis (1H,1H,2H-difluoroethoxy)-phosphazene (SynQuest Labs, Inc.) was used as a “lock mass” internal calibrant (m/z 622.028960 ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Ludovic Spaeth, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 4% for induction then 1-2% for the surgery) and mounted on a stereotaxic frame (Model 68526, RWD Life Science). Body temperature was monitored using a rectal probe and maintained with a heat pad ...
-
No products found
because this supplier's products are not listed.
Maxence LANOIZELET, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (1) 2 hrs at RT or O/N at 4°C in 75 µg/ml of CBM3a-GFP (CZ00571, Nzytech), (2 ...
-
No products found
because this supplier's products are not listed.
Massar Alsamraae, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and 4) slow-release 5-α-dihydrotestosterone pellet (DHT;12.5mg 21-day release; Innovative Research); 5 ...
-
No products found
because this supplier's products are not listed.
Leonardo M. Molina, et al.,
bioRxiv - Biochemistry 2023
Quote:
... or E-cadherin (1:100) (Biorbyt) antibodies ...
-
No products found
because this supplier's products are not listed.
Qin Yang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Eros Di Giorgio, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 4 µM Random hexamers (Euroclone). qRT-PCRs were performed using SYBR green technology (KAPA Biosystems) ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-4 (786-254B; G-Biosciences), Trypsin-5 (EN-151 ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Rui Xu, Yaoyu Feng, Lihua Xiao, L. David Sibley,
bioRxiv - Microbiology 2020
Quote:
... The HCT-8 cells were determined to be mycoplasma-negative using the e-Myco plus kit (Intron Biotechnology).
-
No products found
because this supplier's products are not listed.
Kunal Sharma, et al.,
bioRxiv - Microbiology 2021
Quote:
... the bladder-chip was attached to an adhesive conductive surface followed by coating with a 3 – 4 nm thick layer of gold palladium metal (Quorum Q Plus, Quorum Technologies). Images of the cells were captured using a field emission scanning electron microscope (Merlin ...
-
No products found
because this supplier's products are not listed.
Zeynep Cakir, et al.,
bioRxiv - Neuroscience 2022
Quote:
Peptides were resuspended in 4% formic acid and 3% acetonitrile and directly injected on a 75 μm ID column (New Objective) packed with 25 cm of Reprosil C18 1.9 μm ...
-
No products found
because this supplier's products are not listed.
Haley M. Scott, et al.,
bioRxiv - Immunology 2023
Quote:
... Lenti-X cells were transfected with a pSICO scramble non-targeting shRNA construct and pSICO Srsf7 shRNA constructs targeted at exon 3 and exon 4 of Srsf7 using Polyjet (SignaGen Laboratories). Virus was collected 24 and 48 h post transfection ...
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
No products found
because this supplier's products are not listed.
John Grizzanti, et al.,
bioRxiv - Neuroscience 2022
Quote:
... APP/PS1 mice (n=7- 8 mice/group) were anesthetized via isoflurane and tapered catheters (MRE025 tubing, Braintree Scientific) inserted into the jugular vein and the femoral artery ...
-
No products found
because this supplier's products are not listed.
Adriana C. Rodriguez, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and incubated overnight at 4°C in primary antibodies: ETV4 (Aviva ARP 32263_P050; 1:500 dilution), ERα (Santa Cruz HC-20 ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Matthew J Rames, et al.,
bioRxiv - Biophysics 2023
Quote:
... and 50 nm gold particles (BBI Solutions, EM.GC50/4). Fixation was performed using a buffer made from ...
-
No products found
because this supplier's products are not listed.
Uwe Schwartz, et al.,
bioRxiv - Microbiology 2023
Quote:
... 4 hpi using TRI Reagent (Molecular Research Center, Inc.). Two time series sets of total RNA were prepared from two independent infections ...
-
No products found
because this supplier's products are not listed.
John J. Cordoba, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and centrifuged at 20k ×g at 4 °C for 5 min prior to loading into standard-coated capillary tubes (NanoTemper, GmbH, Munich, Germany). Microscale thermophoresis data were collected on a Monolith NT.115 (NanoTemper ...
-
No products found
because this supplier's products are not listed.
Kirsi Savijoki, et al.,
bioRxiv - Microbiology 2021
Quote:
... Rifampicin solution (TOKU-E) in water at a final concentration of 400 µg mL-1 corresponding to 64 x MIC (minimum inhibitory concentration ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... we measured commercially available Quantum™ FITC-5 MESF (7 μm, Catalog No. 555, lot 14609, Bangs Laboratories) and AccuCheck ERF Reference Particles Kit (3 μm ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Sarah Lockhead, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 4 mM L-glutamine (all from Gemini Bio-Products, #400-110). HEK 293T cells were obtained from ATCC (CRL-3216 ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Claudia Carlantoni, et al.,
bioRxiv - Developmental Biology 2023
Quote:
24-well Plate Softwell Easy Coat hydrogels of different stiffness (0.1, 1, 2, 4 and 25 kPa, Cat #SS24-EC, Matrigen) were coated with 10µg/ml collagen I rat tail diluted in PBS (Cat #A10483-01 ...
-
No products found
because this supplier's products are not listed.
S. John Calise, et al.,
bioRxiv - Biochemistry 2023
Quote:
... HeLa cells were seeded at a density of 4 x 104 cells per well in 8-well chambered glass culture slides (Celltreat #229168) and incubated overnight ...
-
No products found
because this supplier's products are not listed.
Winifred M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4-hydroxybenzoic acid-d4 from CDN Isotopes, and sodium taurocholate-d5 from Toronto Research Chemicals through Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... were produced by mixing 95 mol % 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) with 5 mol % of the respective phosphatidylinositol together with 0.1% Atto647N-DOPE (ATTO-TEC) or Rhodamine-DOPE ...
-
No products found
because this supplier's products are not listed.
Vincenzo Davide Aloi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and treated overnight at 4°C with the primary antibody (rabbit anti-pERK; 1:200, PhosphoSolutions). The pre-treated sections were then incubated for 2 hours at room temperature with goat anti-rabbit conjugated to Cy3 ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The sections were subsequently incubated overnight at 4°C with primary antibodies (S100β 1/200, Sigma S2532; MAP2 1/500, EnCor Biotech CPCA-MAP2 ...
-
No products found
because this supplier's products are not listed.
Sachiko Koyama, et al.,
bioRxiv - Physiology 2019
Quote:
... and went through overnight staining at 4°C with anti-BrdU (1:300, rat, Accurate Chemical Co. #OBT0030). On the second day ...
-
No products found
because this supplier's products are not listed.
Benjamin D. Gastfriend, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EZ spheres were passaged every Friday by mechanical dissociation with 2–4 passes on a McIlwain Tissue Chopper (Campden Instruments, Loughborough, United Kingdom), with half of the resulting aggregates returned to the flask and half discarded ...
-
No products found
because this supplier's products are not listed.
Deniz Irvali, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were broken with zirconia beads 4 × 60 seconds at maximum speed in BeadBug homogenizer (Benchmark Scientific). After 15 minutes of centrifugation at maximum speed ...