-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Omar Al-Jourani, et al.,
bioRxiv - Biochemistry 2022
Quote:
... l-arabino-oligosaccharides (DP = 2-9) obtained commercially (Megazyme) were used as standards at a concentration of 25 μM ...
-
No products found
because this supplier's products are not listed.
Keting Bao, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a 10% CCK-8 solution (Targetmol, C0005) in medium was added and re-incubated for 2 h ...
-
No products found
because this supplier's products are not listed.
Cyrielle Hou, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Images were then opened in Imaris 9 (Oxford Instruments) and used to do the following quantifications ...
-
No products found
because this supplier's products are not listed.
Mireia Rovira, et al.,
bioRxiv - Immunology 2022
Quote:
... 80% of resuspended peptides (8/10 µl in 100% H2O/0.1% HCOOH) were injected on a Triple TOF 5600 mass spectrometer (Sciex, Concord, Canada) interfaced to an EK425 HPLC System (Eksigent ...
-
No products found
because this supplier's products are not listed.
Yuichi Takeuchi, et al.,
bioRxiv - Neuroscience 2020
Quote:
... filled with an AAV vector without dilution (qPCR titer: 3–5×10^12 vg/ml) was installed with an auto-nanoliter injector (Nanoject II; Drummond Scientific, Broomall, PA, USA) and the injector was 9.5 degree leftward tilled from the sagittal plane to avoid the sagittal sinus ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Amy L. Han, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Cells were collected 1 hour after E2 (10−12 M, 10−10 M, 10−8 M) or ethanol (ETOH) (Decon Labs, Inc.) treatment after being EWD for 72 hours ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Physiology 2023
Quote:
... and total glucagon-like peptide-1 (GLP-1) in both the 7-36 and 9-36 forms (Cat #43-GPTHU-E01 ALPCO). For insulin ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Michael Manoharan Valerio, et al.,
bioRxiv - Immunology 2023
Quote:
... and selected with 10 ug/mL of Blasticidin (AG Scientific #3513-03-9). Guide-RNA sequences targeting mouse β2m ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
Cat# 58314-93-5,
Inquire
Ask
Ana C. Puhl, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
Pyronaridine tetraphosphate [4-[(7-Chloro-2-methoxybenzo[b][1,5]naphthyridin-10-yl)amino]-2,6-bis(1-pyrrolidinylmethyl)phenol phosphate (1:4)] (12) was purchased from BOC Sciences (Shirley NY). The purity of this compound was greater than 95% ...
-
No products found
because this supplier's products are not listed.
Montse Flores-García, et al.,
bioRxiv - Neuroscience 2024
Quote:
... encoding Dlight1.3b (AAV1, titter 7,6 × 10^12 vg/mL) was slowly infused with a 2 µL Hamilton Syringe (Hamilton Company, Reno, NV, USA) at a rate of 50 nL/min unilaterally in the NAcc (relative to bregma ...
-
No products found
because this supplier's products are not listed.
Sergio Sastriques-Dunlop, et al.,
bioRxiv - Pathology 2023
Quote:
... MMP-9 (MyBioSource, MBS722532), CD68 (MyBioSource ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HCA-7 cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% FBS (Atlas Biologicals F-0500-D) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
Kyle P. Smith, et al.,
bioRxiv - Biophysics 2024
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B (MRB80 supplemented with 10 µM taxol) : PLL PEG biotin (0.1 mg ml−1, Susos, AG), Streptavidin (0.625 mg ml−1 ...
-
No products found
because this supplier's products are not listed.
Kyla R. Hamling, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Larvae were filmed in groups of 1-8 siblings in a glass tank (93/G/10 55×55×10 mm, Starna Cells, Inc., Atascadero, CA, USA) filled with 24-26 mL E3 and recorded for 48 hours ...
-
No products found
because this supplier's products are not listed.
Antonius A de Waard, et al.,
bioRxiv - Immunology 2020
Quote:
... CD8+ T cell clones recognizing peptides derived from the endogenously expressed proteins USP11 and SSR1(7, 8) were expanded using a standard feeder mix in IMDM supplemented with 5% human serum (Sanquin) and 5% FCS(9).
-
No products found
because this supplier's products are not listed.
Ryoji Amamoto, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... chicken B-galactosidase (1:3000, Aves Labs, cat. #BGL1010), goat B-galactosidase (1:3000 ...
-
No products found
because this supplier's products are not listed.
Ashwani K. Gupta, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 1× GlutaMAX ™ and 8 μM CHIR99021 (Reprocell). From day 4 to day 9 ...
-
No products found
because this supplier's products are not listed.
Katharina MC Klee, et al.,
bioRxiv - Cell Biology 2022
Quote:
Anoctamin 8 (WB 1:500, #HPA049206, Atlas Antibodies), ARHGAP33 (Western-blotting (WB ...
-
No products found
because this supplier's products are not listed.
Andry Andrianarivelo, et al.,
bioRxiv - Neuroscience 2021
Quote:
9-tert-butyl doxycycline hydrochloride (9-TB-dox; Tebu-bio, Le Perray-en-Yvelines, France) was dissolved in a saline solution containing DMSO (5% ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Olivia M. S. Carmo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit α0801 (1:1000, gift from T. de Koning Ward and P. Gilson [9]), rabbit αMESA (1:1000 ...
-
No products found
because this supplier's products are not listed.
Nonthakorn (Beatrice) Apirajkamol, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... with 12 × 2 mm ceria-stabilised zirconium oxide ceramic beads (ZROB20-RNA, Next Advance) in 500 µl of 90% ethanol at 30 ls-1 for 3 min – where the beads ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Sudha Silwal Gautam, et al.,
bioRxiv - Bioengineering 2020
Quote:
... pax 7 (1:1000, rabbit; Lifespan Biosciences, Inc., Seattle, WA, USA), S100 (1:100 ...
-
No products found
because this supplier's products are not listed.
Margot de Looff, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A549-Src-KO cells served as a non-specific binding control The protein mixtures were loaded on a RunBlue 1 mm*10 well 8%-Bis-Tris – gel (Expedeon, Cambridge, UK) after heating the mixture at 70°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Bethany A. Stahl, James B. Jaggard, Alex C. Keene,
bioRxiv - Neuroscience 2019
Quote:
Axotomized and intact control flies were sleep-deprived in groups of 8–10 flies in housing vials mounted on a vortexer (Scientific Industries, Inc, Vortex Genie 2, #SI-0236). Mechanical shaking stimulus was applied using a repeat-cycle relay switch (Macromatic ...
-
No products found
because this supplier's products are not listed.
Sarah K. Rempel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 2-10% FBS (Peak Serum, Inc. #PS-FBS)] ...
-
No products found
because this supplier's products are not listed.
Fadi E. Pulous, et al.,
bioRxiv - Immunology 2021
Quote:
... Skulls were decalcified over the course of 5 days in CUBIC-B solution (10 wt% EDTA (Boston BioProducts), 15 wt% imidazole (Tokyo Chemical Industry CU#1352) ...
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...
-
No products found
because this supplier's products are not listed.
M. Overhoff, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Following secondary antibody labelling 1:50 (12 nm gold goat anti-rabbit antibodies (Dianova), ultrathin sections were embedded and contrasted with 3% Tungstosilicic acid hydrate (w/v ...
-
No products found
because this supplier's products are not listed.
Kyung Ku Jang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The permeabilized organoids were washed 3 times with PBS and incubated with mouse anti-SARS-CoV-2 N antibody (1:1,000, ProSci, 10-605) and rabbit anti-ACE2 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Stephen X. Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and the LED was turned on for the first 8 ms (leaving 2 ms for the LED to turn off before un-blanking the PMT). Using this method ...
-
No products found
because this supplier's products are not listed.
Jacob Fessler, et al.,
bioRxiv - Genomics 2023
Quote:
Cells were arrested at metaphase by overnight colcemid treatment (12-20h) at 0.1 μg/mL (10 μg/mL Colcemid Solution, FUJIFILM Irvine Scientific) in cell culture media ...
-
No products found
because this supplier's products are not listed.
Hailong Yang, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... LM19 and LM20 (Kerafast, diluted 1:10) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Dessislava Malinova, et al.,
bioRxiv - Immunology 2020
Quote:
... B cells were incubated with microbeads (Bangs laboratories) conjugated to anti-Igκ and Ea-peptide (Biotin-GSGFAKFASFEAQGALANIAVDKA-COOH ...
-
No products found
because this supplier's products are not listed.
Jorge Gomez-Deza, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 8 mg/ml polybrene (Thomas Scientific; #C788D57) and mixed with a volume of KIDHGW lentivirus corresponding to an 1600x representation with MOI of 0.3 ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Rongqun Guo, et al.,
bioRxiv - Immunology 2019
Quote:
8-10-week-old B-NDG mice were sublethally irradiated (2.25 Gy) by an X-ray irradiator (RS2000, Rad Source Inc.). 0.5-1 million PSC-derived iHPC were injected into each irradiated B-NDG mouse via retro-orbital veins ...
-
No products found
because this supplier's products are not listed.
Manisha Sinha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and 10% Rhodamine B-conjugated PE (Echelon Biosciences, USA). In an amber vial ...
-
No products found
because this supplier's products are not listed.
Christopher J. DiRusso, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A 0.4 M solution of 2-(7-aza-1Hbenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) (Chem-Impex International) was prepared in DMF and 2.5 ml was used to dissolve 1 mmol of each Nα Fmoc-protected aa (Chem-Impex International) ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... COVID-19 convalescent plasma was diluted (1:10) and incubated with recombinant SARS-CoV-2 full-length Spike (BPS Bioscience) for 1 h at 37 °C prior to adding to an hACE2 pre-coated ELISA plates ...
-
No products found
because this supplier's products are not listed.
Dhanu Gupta, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2 µl of protein A conjugated 10 nm gold nanoparticles (BBI Solutions) were added and incubated for 45 minutes.
-
No products found
because this supplier's products are not listed.
Rosanna P. Baker, et al.,
bioRxiv - Microbiology 2021
Quote:
... Melanization of the cultures was monitored by photographing and quantifying pigment intensities (as described above) for 2 mL samples that had been transferred to the wells of a transparent 12-well plate (Celltreat, 229112). After incubation for 10 d at 30°C or 16 d at 37°C ...
-
No products found
because this supplier's products are not listed.
Bin Qiu, et al.,
bioRxiv - Physiology 2023
Quote:
... the cells were starved with DMEM/Ham’s F-12 1:1 in a mixture of choline-sufficient (CS) medium (#DFL13-500ML, Caisson Labs) for 24 hours ...
-
No products found
because this supplier's products are not listed.
Eline Berends, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 7 and 13 using the tail- cuff plethysmography (CODA, Kent Scientific) as previously described (Foulquier et al. ...