-
No products found
because this supplier's products are not listed.
Alanna V. Van Huizen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
No products found
because this supplier's products are not listed.
Angana A.H. Patel, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 2 mM dimethyl-2-oxoglutarate (DMG, #349631 Sigma-Aldrich), 500 µM N-acetyl-L-cysteine (NAC ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Krzysztof Mikołajczyk,
bioRxiv - Biochemistry 2024
Quote:
... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
Prepared to contain higher clostripain activity. Suggested for bone, heart, liver, thyroid and...
Cat# LS004176,
1 gm, $215.00
Ask
Charley Mackenzie-Kludas, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 1 μg/ml L-1-tosylamido-2-phenylethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemicals). Plaque forming units (PFU ...
-
No products found
because this supplier's products are not listed.
Abhishek Jamwal, et al.,
bioRxiv - Microbiology 2023
Quote:
... IL-2 and IL-7 (Biolegend) were added at 10 ng/ml final concentration ...
-
No products found
because this supplier's products are not listed.
Žiga Avsec, et al.,
bioRxiv - Genomics 2020
Quote:
... ɑ-Pbx 1/2/3 (Santa Cruz, sc-888), and ɑ-Zic3 (Abcam ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Shuai A. Huang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... BCL-2 (Clone#7/BCL-2, BD Bioscience), MCL-1 (Cat#600-401-394 ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Maria-Luisa del Rio, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
No products found
because this supplier's products are not listed.
Franck Dumetz, et al.,
bioRxiv - Microbiology 2021
Quote:
... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
John B. G. Mackey, et al.,
bioRxiv - Immunology 2021
Quote:
... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
No products found
because this supplier's products are not listed.
Nozomu Matsumoto, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
No products found
because this supplier's products are not listed.
Manuel van Gijsel-Bonnello, et al.,
bioRxiv - Immunology 2021
Quote:
... IL-2 and IL-7 were purchased from Peprotech, reconstituted in sterile water ...
-
No products found
because this supplier's products are not listed.
Joshua Mills, et al.,
bioRxiv - Microbiology 2023
Quote:
... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
No products found
because this supplier's products are not listed.
John P. Gillies, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1-1/2 coverslips (Corning) sonicated in 100% ethanol for 10 min were used for the flow-chamber assembly ...
-
No products found
because this supplier's products are not listed.
Eirik S. Nilssen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and dimethyl sulfoxide (2%; DMSO; VWR Chemicals) without prior dehydration ...
-
No products found
because this supplier's products are not listed.
Kentson Lam, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Then 3-(4,5-dimethyl thiazol- 2-yl)-2,5-diphenyl tetrazolium bromide (MTT) labeling reagent (Roche) was added followed by solubilization buffer 2h later ...
-
No products found
because this supplier's products are not listed.
Ryo Okuda, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Biophysics 2021
Quote:
... and Quantifoil carbon grids with 7 µm holes (S 7/2, Electron Microscopy Sciences) were cleaned with 100% chloroform to remove the plastic cover ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Danielle L. Tomasello, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Vesicular Glutamate 1 and 2 (VGlut1/2, Synaptic Systems) or Postsynaptic Density 95 (PSD95 ...
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Rachel Hills, et al.,
bioRxiv - Neuroscience 2022
Quote:
... sonic hedgehog C25II (days 2-7, 100ng/mL, R&D Systems). After day 13 of differentiation ...
-
No products found
because this supplier's products are not listed.
Soh Ishiguro, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
No products found
because this supplier's products are not listed.
Mai-Anh T. Vu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or Drd1-cre (Figures 1, 2, 7, Jackson labs, strain #030329) ages 11 to 24 weeks were injected with AAVs to express genetically encoded proteins for optical measurements and manipulations (see Supplementary Table 1) ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Sophia Michelchen, Burkhard Micheel, Katja Hanack,
bioRxiv - Immunology 2020
Quote:
... 2 ng/ml interleukin 7 (IL7) (Miltenyi Biotec, Bergisch-Gladbach, Germany) and/or 1 μg/ml lipopolysaccharide (LPS ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Katrin Linda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Medium was refreshed every 2-3 days and cells were passaged 1-2 times per week using an enzyme-free reagent (ReLeSR, Stem Cell Technologies). For autophagy induction cells were treated with 200 µM Rapamycin (ChemCruz ...
-
No products found
because this supplier's products are not listed.
Olaf Klingbeil, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... LATS1/2 (GeneTex, GTX87014, 1:1,000), p-LATS1/2 (T1079/T1041 ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Sebastian N.W. Hoernstein, et al.,
bioRxiv - Plant Biology 2022
Quote:
... diluted 1:10,000 in 2% TBST with 2% Blocking (GE Healthcare), was applied for 1 h.
-
No products found
because this supplier's products are not listed.
Jari Jukkola, et al.,
bioRxiv - Neuroscience 2023
Quote:
2- to 3-month-old C57/Bl6N (Charles River) female mice were used in all experiments ...
-
No products found
because this supplier's products are not listed.
Masaharu Somiya, Shun’ichi Kuroda,
bioRxiv - Cell Biology 2021
Quote:
... Synergy 2 (BioTek).
-
No products found
because this supplier's products are not listed.
Xiaocui Luo, et al.,
bioRxiv - Immunology 2023
Quote:
... or 2 μg/ml anti-mouse IgM F(ab’)2 (Jackson ImmunoResearch), or 5 μg/ml anti-mouse CD40 (clone FGK4.5/ FGK45 ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Amelia Trimarco, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 20.000 rpm for 2 hours (Beckman). Collected viral particles were then suspended in DMEM and stored to –80°C ...
-
No products found
because this supplier's products are not listed.
Poonam Roshan, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... NFIB (1:2000 in 2% milk, Bethyl), Snail (1:1000 ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...