-
No products found
because this supplier's products are not listed.
Pirunthan Perampalam, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cytokeratin (human specific cytokeratin 7 and 8, ZETA Corporation #Z2018ML, 1:200), EpCAM (Cell Signaling Technologies ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Hajar Mikaeili, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 7-10 µm thick) and Human Prostate Frozen Sections (HF-408, 7-10 µm thick) were obtained commercially from Zyagen (www.zyagen.com) via AMS Biotechnology (https://www.amsbio.com ...
-
No products found
because this supplier's products are not listed.
Kei Jokura, et al.,
bioRxiv - Neuroscience 2023
Quote:
... COS-7 cells (Angio-proteomie, CAT no. cAP-0203) with a low endogenous level of soluble guanylate cyclase activity were used ...
-
No products found
because this supplier's products are not listed.
Jessica Hoff, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 U mL-1 DY-636 conjugated Phalloidin (Dyomics) for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
PRG-1 (EDTA -dPBS Solution) prepares the cells for PRG-2 (containing Trypsin) processing. Cell...
Cat# 4Z0-610,
100.0 mL, $68.0
Ask
Anna E. Boczula, et al.,
bioRxiv - Microbiology 2021
Quote:
... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The established stable cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 4∼5% fetal calf serum (FCS; Thermo Fisher Scientific, or Nichirei Biosciences Inc) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
ELISA, ICC/IF
Cat# CDC-36,
0.1 mg, Inquire
Ask
Konner Cool, et al.,
bioRxiv - Microbiology 2021
Quote:
... VA) and Vero E6 cells stably expressing transmembrane serine protease 2 (Vero-E6/TMPRSS2)7 were obtained from Creative Biogene (Shirley, NY) via Kyeong-Ok Chang at KSU and used for virus propagation and titration ...
-
No products found
because this supplier's products are not listed.
Jianbo Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... sealed with 20-mm Crimp Cap (95025-01-1S, MicroSolv). Then all the vials were transferred into an anaerobic chamber ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Hafner, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Expanded gels were transferred into 50×7 mm glass bottom dishes (WillCo Wells) for imaging ...
-
No products found
because this supplier's products are not listed.
Joseph C. Reynolds, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Membranes were blocked for 1 hour using 5% BSA (Akron Biotech, USA, #AK8905-0100) in tris-buffered saline containing 0.05% Tween-20 (Bio-Rad #161-0781 ...
-
No products found
because this supplier's products are not listed.
Lone Buchwaldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mycelium plugs were cut with a 7 mm cork borer from the margin of actively growing cultures and placed on 3 × 7 cm pieces of stretched Parafilm (Bemis Company Inc, Oshkosh, WI, USA) with the mycelium facing up ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Kawano, et al.,
bioRxiv - Neuroscience 2019
Quote:
... in two stages and using a vertical pipette puller (PB-7, Narishige International USA). The resistance of the recording electrode was 5-7 MΩ ...
-
No products found
because this supplier's products are not listed.
Glennis A. Logsdon, et al.,
bioRxiv - Genomics 2020
Quote:
... and then incubated with a mouse monoclonal anti-CENP-A antibody (1:200, Enzo, ADI-KAM-CC006-E) and rabbit monoclonal anti-5-methylcytosine antibody (1:200, RevMAb, RM231) for 3 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Asuka Hirooka, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... a 10-amino acid-peptide called NMC or GRP-10 (AssayPro, St. Charles, MO, USA) for 48 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Yannick O Alexandre, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight at 4°C with 10 μg/ml HSV-1 inactivated Vero cell extract (Advanced Biotechnologies). Unbound protein was washed away (PBS 0.05% Tween20 ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Nobuhiko Hamazaki, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and washed and mounted in Fluoro-KEEPER antifade reagent (Nacalai USA). For phalloidin staining ...
-
No products found
because this supplier's products are not listed.
Satu Lehti, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Four fractions of 500 µl (fractions 1-4) were collected after the void volume (2.7 ml) with an automated fraction collector (IZON Science, USA), combined and concentrated using ultrafiltration (Amicon Ultra ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Kathleen N. Brown, et al.,
bioRxiv - Pathology 2023
Quote:
... and the cells were resuspended in ~500 μL 1% FBS in PBS and transferred to polystyrene 5 ml flow cytometry tubes (MTC Bio). The samples were placed on ice and protected from light until flow cytometry could be performed ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... 5 μl PPP Master Mix (Top-Bio) and 3 μl PCR H2O (Top-Bio) ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or pTer1 control vector (pTer1 cells)16 were authenticated by CellCheck human 16 Plus Test (9 human STR marker profile + 7 additional Human STR marker, Inter-species contamination Test and STAT-mycoplasma testing) (IDEXX Analytics). They were grown in Dulbecco’s Modified Eagle Medium:F-12 (DMEM/F-12 Glutamax ...
-
No products found
because this supplier's products are not listed.
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and 5% BriClone Hybridoma Cloning Medium (QED Bioscience). One hundred units/ml penicillin ...
-
No products found
because this supplier's products are not listed.
Inge M. N. Wortel, et al.,
bioRxiv - Microbiology 2022
Quote:
... The sample was diluted 1:10 with BHI and 8 μl of 1:10 dilution was used on a non-charged slide (Globe Scientific Cat No 1324W) to check motility ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the Fe with 1wt% VH precursor mixture was loaded into a custom-build consolidation die and high-pressure cold-sintered at 2.5 GPa (corresponding to 5 t for 5 mm diameter die) and RT using manual press (Carver, Wabash, IN, USA) to obtain the drug-loaded metal (Supplementary Materials ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Justin Riddle, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The P4 (4-pregenen-3,20-dione) enzyme immunoassay kit was provided by Salimetrics Inc (State College ...
-
No products found
because this supplier's products are not listed.
Thibault Scalvenzi, et al.,
bioRxiv - Genomics 2021
Quote:
... 20 and 5 μm filters (nylon 40 μm cell strainer from BIOLOGIX; 20 μm net ring from Pharmacia Fine chemicals ...
-
No products found
because this supplier's products are not listed.
Qian Li, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mM MgCl2) was prepared on a Gradient Station platform (Biocomp Instruments). 450 µl of the lysate was carefully layered on top of the sucrose gradient and centrifuged at 35000 rpm (210000g ...
-
No products found
because this supplier's products are not listed.
Mariano R. Rodríguez-Sosa, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Ad-MSC were incubated for 30 min with 1/3 dilution of Propidium Iodide (PI) solution (Cytognos, Spain) in PBS 1X ...
-
No products found
because this supplier's products are not listed.
Youichi Tajima, Futoshi Shibasaki, Hisao Masai,
bioRxiv - Cancer Biology 2022
Quote:
... Proteins were separated by SDS-PAGE on 4-20 % gradient precast gel (EZBiolab Precast Gel, WSHT, Shanghai) at 100 V for 75 min ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Julia Ryvkin, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 5 heads were transferred into soft tissue homogenizing CK 14 tubes containing 1.4 mm ceramic beads (Bertin corp.) prefilled with 600 ul of cold (−20 °C ...
-
No products found
because this supplier's products are not listed.
Ankita Gumaste, et al.,
bioRxiv - Neuroscience 2022
Quote:
Components for the artificial sniffing system used a mounted 5 mL glass syringe piston (Air-Tite, 7.140-33) coupled via a custom 3D-printed connector to a linear solenoid actuator (Soft Shift Part# 192907-023 ...
-
No products found
because this supplier's products are not listed.
W. Bai, et al.,
bioRxiv - Bioengineering 2020
Quote:
... or 5 mL of the gas phase was injected into a 15 mL helium-flushed septum-capped glass vial (Exetainer, Labco, Houston), using a HamiltonTM gas-tight syringe ...
-
No products found
because this supplier's products are not listed.
Mark E. Corkins, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... then moved to a 1.5ml tube containing 1:1 1xMMR:Optiprep (Cosmo Bio Usa Inc AXS1114542) with a glass pipette ...
-
No products found
because this supplier's products are not listed.
Rita F. Santos, et al.,
bioRxiv - Immunology 2022
Quote:
... for 1 h with 1 μg/ml of the sAg staphylococcal enterotoxin E (SEE) (Toxin Technologies). After 24 h of culture at 37 °C ...
-
No products found
because this supplier's products are not listed.
Linglei Jiang, et al.,
bioRxiv - Immunology 2022
Quote:
... IgA (1:250, Brookwood Biomedical, AL, USA) or IgM (1:250 ...
-
No products found
because this supplier's products are not listed.
Matheus F. Sathler, et al.,
bioRxiv - Neuroscience 2022
Quote:
... NIH: HIV-1 IIIB gp120 Recombinant Protein from ImmunoDX, LLC ...