-
No products found
because this supplier's products are not listed.
Suprama Datta, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cells were gently washed three times 2-hour post-infection and incubated in DMEM containing 1:1000 dilution of anti-VSV-G antibody (Kerafast: 8G5F11) to eliminate residual ΔG-VSV particles at 37°C ...
-
No products found
because this supplier's products are not listed.
Koen J.A. Martens, et al.,
bioRxiv - Biophysics 2020
Quote:
... was then guided into a 4f geometry using the following lenses (1: f = 200mm, 2: f = 100mm, 3: f = 100mm) towards a Prime 95B sCMOS camera (Photometrics, Tucson, AZ, USA), resulting in an effective 115 by 115 nm pixel size ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Iliodora V. Pop, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mice (1-2 months old) were injected with 4% (w/v) FG solution in saline (Fluorochrome). Mice were anesthetized with isoflurane and the area above and around the cerebellar region was prepared for surgery ...
-
No products found
because this supplier's products are not listed.
Jasmine M Manouchehri, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The concentrations of sulfatase 1 and 2 (Lifespan Biosciences, Cat# LS-F66757-1 and LS-F35926-1) were measured in the supernatants of the examined cell lines at basal level via enzyme-linked immunoassay (ELISA ...
-
No products found
because this supplier's products are not listed.
Ioannis Oikonomakos, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... cells were cultured from day 0 to day 2 in 1:1 ReproFF2 (REPROCELL RCHEMD006) or StemFit™ Basic04CT (REPROCELL ASB04CT) ...
-
No products found
because this supplier's products are not listed.
Marta Vranas, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or mouse anti-mitofusin 2 (1:50, mAb 661-757, Abnova) was added for overnight incubation at 4 °C ...
-
No products found
because this supplier's products are not listed.
Kerri L. Miazgowicz, et al.,
bioRxiv - Microbiology 2022
Quote:
... Transfected cells were rapidly cooled and stained in blocking solution (dPBS with 2% (v/v) bovine serum albumin (BSA)) containing anti-MXRA8 (1:100, W040-3, MBL International), anti-hTIM1(1:100 ...
-
No products found
because this supplier's products are not listed.
Yusuke Nishimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
Akt1/2/3 inhibitor MK-2206 dihydrochloride (ApexBio, A3010), Rapamycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Nanami Kikuchi, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... and 2 µl of 1% w/v amine polystyrene fluorescent yellow particles (NH2-beads, Spherotech, Inc) or carboxyl polystyrene fluorescent yellow particles (Spherotech ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Chetan Kumar Arya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Wizard Classic 1 and 2 (Rigaku Japan). Crystals of DMFase were obtained by mixing 200 nl of protein in buffer A with equal volumes of precipitant ...
-
35 mm glass bottom dish with 4 chambers, 20mm microwell, #1 cover glass (0.13-0.16mm). Designed...
Cat# D35C4-20-1-N,
100/case, $184.00
Ask
Laura R Lee, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 5 mL of 1/2 MS with 2% low melt agarose was cast into imaging cuvettes (CellVis product number #C1-1.5H-N) after being filtered through a 0.45 micron nylon filter to remove any particulates that might disturb the path of the light sheet to prepare media “blankets” ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Zoe L. Watson, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... and 0.5 mM 2’-NH2-ATP (2’-amino-2’-deoxyadenosine-5’-triphosphate, purchased from Axxora). Reactions were incubated at 37 °C for 2 h ...
-
No products found
because this supplier's products are not listed.
Biswarathan Ramani, et al.,
bioRxiv - Genomics 2023
Quote:
... 2: rabbit anti-tRFP (1:1,000 dilution, polyclonal, Evrogen, AB233). The following secondary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...
-
No products found
because this supplier's products are not listed.
Robert T. Schooley, et al.,
bioRxiv - Microbiology 2021
Quote:
... 1-O-octadecyl-2-O-benzyl-sn-glycerol was obtained from Bachem, Torrance ...
-
No products found
because this supplier's products are not listed.
Rebecca A. Callahan, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 100 Hz pulse trains (1 ms pulse width) at 2-5 V (A-M systems Isolated Pulse Stimulator Model 2100). Confocal imaging was performed as described above ...
-
No products found
because this supplier's products are not listed.
J. Z. Alex Cheong, et al.,
bioRxiv - Microbiology 2021
Quote:
... with 0.2 g of 1 mm sterile glass beads for 10 min at full-speed on a Vortex-Genie 2 (Scientific Industries, Bohemia, NY) before serial dilution and spot plating 20 μL on TSA plates with no antibiotic supplementation.
-
No products found
because this supplier's products are not listed.
Jason I. Griffiths, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Tissue was homogenized by mincing with a sterile razor blade in 2 mL of sterile 4:1 Lysis Buffer (10mM Tris-HCl, pH 7.8 (Teknova, Cat# T1078), 146mM NaCl (Alfa Aesar ...
-
No products found
because this supplier's products are not listed.
Pinelopi Pliota, et al.,
bioRxiv - Genetics 2022
Quote:
... slow-2 and pgl-1 using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner ...
-
No products found
because this supplier's products are not listed.
Preksha Gupta, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Peak 2 (RCP-60-50-2) and Polystyrene DVB-COOH microspheres from Bangs Laboratories, Inc (PC07001 ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Sumin Jang, Elias Gunmit, Hynek Wichterle,
bioRxiv - Developmental Biology 2022
Quote:
... ISL1/2 (Goat, 1:5000 Neuromics GT15051), MNX1 (Guinea pig ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F1,
1.0 ea, USD $390.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Seiya Yamada, et al.,
bioRxiv - Neuroscience 2021
Quote:
... were blocked for 2 h at 4°C with 5% normal goat serum in PBST and incubated with anti-EGFP (1:2000, Aves Labs, GFP-1010), anti-HA (1:500 ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
No products found
because this supplier's products are not listed.
Dony Maiguel, et al.,
bioRxiv - Biochemistry 2022
Quote:
... [1-14C]oleic acid (C18:1) and [1-14C]linoleic acid (C18:2) were obtained from American Radiolabeled Chemicals (St. Louis, MO). [1-14C]stearic acid was obtained from Amersham Biosciences ...
-
No products found
because this supplier's products are not listed.
Maria Chechenova, et al.,
bioRxiv - Pathology 2023
Quote:
... 1-2 day old adults were placed in standard plastic vials (Genesee Scientific), not more than 35 flies/vial ...
-
No products found
because this supplier's products are not listed.
Dmitri Dormeshkin, et al.,
bioRxiv - Immunology 2022
Quote:
... The membrane was washed and then incubated with 1:5 000 SARS-COV-2 Spike RBD Polyclonal Antibody antibodies (#E-AB-V1006, Elabscience) for 1 h at RT and with 1:10 000 Goat Anti-Rabbit-HRP (#31460 ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Claudia Z. Han, et al.,
bioRxiv - Genomics 2021
Quote:
... 1 mM EDTA)) for mechanical dissociation using a 2 ml polytetrafluoroethylene pestle (Wheaton, 358026)1 ...
-
No products found
because this supplier's products are not listed.
Daniyal J Jafree, et al.,
bioRxiv - Pathology 2024
Quote:
... mouse monoclonal anti-platelet and endothelial cell adhesion molecule 1 (PECAM1/CD31 Aligent, GA610, clone: JC70A, 1:50) rabbit polyclonal anti-ssu-2 homolog (SSUH2, Atlas Antibodies, HPA049777, 1:100), rabbit polyclonal anti-fibulin 2 (FBLN2 ...
-
No products found
because this supplier's products are not listed.
Glenn F. W. Walpole, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PtdIns(4)P diC16 (Echelon Biosciences P-4016-2); PtdIns(3,4)P2 (Echelon Biosciences P-3416-2) ...
-
No products found
because this supplier's products are not listed.
Shaohe Wang, Kazue Matsumoto, Kenneth M. Yamada,
bioRxiv - Developmental Biology 2020
Quote:
... 4 mL 5× PEG reagent (System Biosciences, LV825A-1) was added and mixed by pipetting ...
-
No products found
because this supplier's products are not listed.
Xiao He, Yunlu Kang, Lei Chen,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM EGTA and 1 mM PMSF) with a disperser (IKA T18 digital ULTRA-TURRAX). The crude lysis was ultracentrifugated at 35 ...
-
No products found
because this supplier's products are not listed.
Phuong T. Lam, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Corning)-coated dishes in NIM at an approximate density of 20 aggregates per cm2 and switched to DMEM/F12 (3:1) supplemented with 2% Gem21 NeuroPlex (without vitamin A, Gemini Bio-Products, 400-161), 1X NEAA ...
-
No products found
because this supplier's products are not listed.
Oscar L. Rodriguez, et al.,
bioRxiv - Genomics 2022
Quote:
... 1-2 micrograms of high molecular weight DNA was sheared using g-tube (Covaris, Woburn, MA) to 5-9 Kbp at a 7000 RPM and size selected using the 0.75% DF 3-10kb Marker S1-Improved Recovery cassette definition on the Blue Pippin (Sage Science) ...
-
No products found
because this supplier's products are not listed.
Brianna M. Doratt, et al.,
bioRxiv - Immunology 2023
Quote:
Freshly thawed UCBMCs (1-2×106 cells) were stained with Ghost Violet 540 (Tonbo Biosciences, San Diego, CA) for 30 min at 4C in the dark before being incubated with Fc blocker (Human TruStain FcX ...
-
No products found
because this supplier's products are not listed.
Chao Hu, et al.,
bioRxiv - Immunology 2020
Quote:
... type 2 (Trevigen, USA). Drops of 40 μl BME-cell suspension were added into 24-well plates and solidified at 37°C for 10-20 min ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... COVID-19 convalescent plasma was diluted (1:10) and incubated with recombinant SARS-CoV-2 full-length Spike (BPS Bioscience) for 1 h at 37 °C prior to adding to an hACE2 pre-coated ELISA plates ...
-
No products found
because this supplier's products are not listed.
A. Schlör, et al.,
bioRxiv - Immunology 2022
Quote:
... 1 μg SARS-CoV-2 Spike protein (antibodies-online, ABIN6952734) per lane was applied onto a 4-12% SDS polyacrylamide gradient gel ...
-
No products found
because this supplier's products are not listed.
Philipp Gaugler, et al.,
bioRxiv - Plant Biology 2022
Quote:
... They were then diluted 1:200 in 2 mL fresh medium supplemented with 6 μCi mL−1 [3H]-myo-inositol (30–80 Ci mmol−1; Biotrend; ART-0261-5) and grown overnight at 28°C in a spinning wheel ...
-
No products found
because this supplier's products are not listed.
Irini Topalidou, et al.,
bioRxiv - Cell Biology 2019
Quote:
Approximately 1-2 × 105 cells per well were plated onto cover slips (Thomas Scientific #121N79) placed in 24-well cell culture plates ...
-
LC Laboratories' Product Number T-8448 - Torin 2, Free Base (mTOR Inhibitor XII, CAS...
Cat# T-8448, SKU# T-8448_250mg,
250 mg, $830.00
Ask
Gregory Naylor, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 1 g of fasudil (LC Laboratories, F-4660) was dissolved in 50 ml distilled water giving a final concentration of 20 mg/ml ...
-
No products found
because this supplier's products are not listed.
Hao Liu, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 2-amino-N-(2-aminoethyl)-benzamide (AEAB) was purchased from Chem-Impex International (Wood Dale ...
-
No products found
because this supplier's products are not listed.
Shahanshah Khan, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 M (MyBioSource, MBS8574735) and SARS-CoV-2 E (MyBioSource ...