-
No products found
because this supplier's products are not listed.
Angela Lai, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Blood samples were collected at the inlet and outlet for measuring blood cell count (2 mL in K2EDTA) and aPTT/PT (3 mL in 1:9 citrate) using a clinical hematology analyzer (Diagnostica Stago Start 4, Siemens, Germany).12 If aPTT was outside the range of 20-50 seconds ...
-
No products found
because this supplier's products are not listed.
Meitham Amereh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Potassium iodide (CAS# 7681-11-0) from Caledon laboratory, Citric acid monohydrate (CAS# 5949-29-1 ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
Michael L. Nosella, et al.,
bioRxiv - Biochemistry 2021
Quote:
... with the exception that the alkyne-biotin detection reagent from the latter kit was replaced with methoxy-PEG-alkyne (average MW ∼5kDa; Biochempeg, Watertown, MA, USA), which was present at a final concentration of 5mM during the Click chemistry step ...
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Jensen H. C. Yiu, et al.,
bioRxiv - Systems Biology 2023
Quote:
Immunoblotting was conducted as described previously.11 The anti-flagellin antibodies were purchased from Covalab Inc ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Changzheng Song, et al.,
bioRxiv - Plant Biology 2021
Quote:
... (±)-GR24 (rac-GR24, CAS No: 76974-79-3) and Karrikin1 (KAR1, CAS No: 857054-02-5) were purchased from Chiralix (Nijmegen, Netherland). GR244DO was obtained from StrigoLab (Torino ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... or 4-dimethylaminophenylazophenyl-4’-maleimide (DABMI, Setareh Biotech). After labeling ...
-
No products found
because this supplier's products are not listed.
Riley A. Suhar, et al.,
bioRxiv - Bioengineering 2021
Quote:
... for HA-B or Ald- CH2-PEG3-Azide (BroadPharm, BP-21715) for HA-A in extra-dry DMSO (100 mg mL-1 ...
-
No products found
because this supplier's products are not listed.
Jennifer Eng, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Formalin-fixed paraffin-embedded (FFPE) human tissues were sectioned at 4-5 microns and mounted on positively charged slides (Tanner Adhesive Slides, Mercedes Medical, TNR WHT45AD). The slides were baked overnight at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
Abishek Chandrashekar, et al.,
bioRxiv - Microbiology 2022
Quote:
... or B.1.1.529 (Omicron; GISAID ID: EPI_ISL_7358094.2) Spike proteins (21st Century Biochemicals). 106 peripheral blood mononuclear cells well were re-suspended in 100 µL of R10 media supplemented with CD49d monoclonal antibody (1 µg/mL ...
-
WB, ChIP, DB, ICC/IF
Cat# CDC-104,
0.025 mg;0.05 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
Cat# F107,
USD $169.00/EA
Ask
Whee-Soo Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... silica-coated nanoparticles (1 mg) were then coated with m-dPEG12-TFP ester (9 mg, Quanta BioDesign, USA), Azido-dPEG12-TFP ester (1 mg ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Kelly M. Hennessey, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the C terminus of GL50803_8445 was tagged with an 11-amino acid flexible linker and the fluorescent protein mNeonGreen (Allele Biotechnology). The mNG-N11-Neo vector was constructed for this purpose by amplifying mNeonGreen using the primers listed in Table S1 ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Patrícia Aline Gröhs Ferrareze, et al.,
bioRxiv - Microbiology 2020
Quote:
... manual correction of genes from chromosomes 9 and 14 was performed with the software Artemis (Carver et al., 2012), the R265 genome (NCBI assembly GCA_002954075.1) ...
-
No products found
because this supplier's products are not listed.
Celeste Riepe, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from the 9 sublibraries were combined into 500 mL Micro-Carrier Spinner Flasks (Bellco Glass, Vineland, NJ, Cat#1965-02500) such that each sgRNA library was represented at 1000X (e.g. ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Dakota R. Robarts, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and GenX (Synquest Laboratories cat # 2122-3-09, lot # 00008887) were dissolved in 0.5% Tween-20 at final concentrations of 0.067 g/L ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Anurag Pandey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anaesthetised mice were secured in a Narishige SR-6 stereotaxic frame (Narishige International, London, UK); the skull was thinned over a 2 x 2mm area above the barrel-field centerd on the D1 barrel (at approximately 3mm lateral to the midline and 1.5 mm caudal to bregma) ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Kristina Astleford-Hopper, et al.,
bioRxiv - Cell Biology 2022
Quote:
3-month-old femora were isolated and fixed in Z-fix (Anatech LTD) and placed in 10% EDTA (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Abrar Choudhury, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... whole skulls were subsequently embedded in 5% low-melt agarose (Precisionary) and cut into 300µm sections on a Vibratome (VT1000S ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...