-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Alyssa R. Phillips, et al.,
bioRxiv - Plant Biology 2023
Quote:
... About 1 mm of the tip (meristem and root cap) was excised and transferred to a tube containing 20 µL of 3% cellulase R-10 (Desert Biologicals, Phoenix, AZ) and 1.25% pectolyase Y-23 (Desert Biologicals ...
-
No products found
because this supplier's products are not listed.
Aldo E. García-Guerrero, et al.,
bioRxiv - Microbiology 2024
Quote:
... Membranes were blocked at room temperature for 1 hour in 5% skim milk/PBS and probed overnight at 4°C with 1:1000 dilutions of rabbit anti-HSP60 (Novus NBP2-12734) and goat anti-GFP (Antibodies.com A121560) antibodies ...
-
No products found
because this supplier's products are not listed.
Tongcui Ma, et al.,
bioRxiv - Microbiology 2023
Quote:
... or conjugated in-house with X8 antibody-labeling kits (Standard BioTools) and stored at 4°C in Antibody Stabilizer (Boca Scientific) supplemented with 0.05% sodium azide ...
-
No products found
because this supplier's products are not listed.
Julia Hansen, et al.,
bioRxiv - Microbiology 2022
Quote:
... ethyl-[R]-cysteinyl-[S]-lysyl-[S]-lysyl-[S]-lysyl-[S]-lysyl-[S]-lysine(ε-aminocaproyl-∈-aminocaproyl-biotinyl) x 3 CF3COOH (EMC Microcollections, Tübingen, Germany) at 1.5 mg/ml in carbonate buffer (pH 9.2 ...
-
No products found
because this supplier's products are not listed.
Anuj kumar Murmu, et al.,
bioRxiv - Genomics 2022
Quote:
The predicted peptide sequence of Mucin 2 of indigenous duck was derived by Edit sequence (Lasergene Software, DNASTAR) and then aligned with the peptide of other chicken breed and avian species using Megalign sequence Programme of Lasergene Software ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Hongbing She, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR was performed in a total reaction volume of 10 μL containing 5 μL 2×Taq Master Mix (CoWin Biosciences, China), 0.25 μL forward and reverse primer ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Jonathan M Budzik, et al.,
bioRxiv - Microbiology 2019
Quote:
Immunostaining for LC3 was performed with blocking and permeabilization buffer (0.3% Triton X-100, 2% bovine serum albumin) and anti-LC3 (clone 2G6, Nanotools #0260-100/LC3-2G6) at a dilution of 1:200 for 3 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... day 0 and day 21) with 5 μg/dose of recombinant SARS-CoV-2 Spike protein (S1+S2 extracellular domain) (Bon Opus Biosciences, #BP040) adjuvanted with 100 μg/dose alhydrogel adjuvant 2% (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Gaurang Patel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... followed by 20 minutes of boiling at 90°C in Pretreat 2-target retrieval buffer treatment (ACD, 320043) in Oster Steamer (IHC World, LLC, Model 5709) and 30 minutes of Pretreat 3-using protease plus treatment (ACD ...
-
No products found
because this supplier's products are not listed.
Pranjali Beri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The uncured LSR was vulcanized at 150°C for 2 minutes using a hydraulic lab press equipped with heated platens (Carver Bench Top Auto Press) then demolded from the tool.
-
No products found
because this supplier's products are not listed.
Nada Sallam, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... or weighed frozen (hippocampus or adipose tissue) and placed into glass tubes with 2 mL acetonitrile and 100 μL deuterated internal standard (Cerilliant, Round Rock, TX, USA). Hippocampal or adipose samples were first homogenised with a glass rod ...
-
No products found
because this supplier's products are not listed.
Ken Shirato, Jun Takanari, Takako Kizaki,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... the cells were co-treated with the indicated concentrations of ETAS®50 or dextrin and 100 ng/mL of SARS-CoV-2 spike recombinant protein S1 subunit (Arigo Biolaboratories, Hsinchu City, Taiwan) for 1 to 24 h ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
Cat# ACM18035080,
Inquire
No citation found on bioRxiv
-
Cat# CDC10-0339,
1 kg, Inquire for price
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Rabbit polyclonal antibody to G beta 4
Cat# CQA4575,
200 ul USD $350.0, 100 ul USD $220.0, 50 ul USD $150.0
No citation found on bioRxiv
-
Catalog Number: MDP0640 (500 ug)
Conantokin G is a high quality Conantokin G. This product has...
Cat# MDP0640,
USD $695.0
No citation found on bioRxiv
-
G-130, also known as GP-130, is a drug with stimulant and anorectic effects, related to...
Cat# SMD058,
Customizable size, Inquiry
No citation found on bioRxiv
-
Cat# RVs-051,
1 vial, USD $528
No citation found on bioRxiv
-
Cat# RP-2916,
10 mg; 100 mg, Inquire
No citation found on bioRxiv
-
2-(4'-Hydroxybenzeneazo) benzoic acid (HABA), is a recrystallized matrix for matrix assisted...
Cat# CPAS100022,
inquiry, contact supplier for pricing
No citation found on bioRxiv
-
Colorless Silver Antimicrobial Solution, 2-10nm
Cat# ANT-0022,
25 kg, USD $4700.0
No citation found on bioRxiv
-
Perfusable 12-well integral insert system (pack of 4)
Cat# PP-A012-0004,
4 case, $1670.00
No citation found on bioRxiv