-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... or 4-dimethylaminophenylazophenyl-4’-maleimide (DABMI, Setareh Biotech). After labeling ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Gaurav Gupta, et al.,
bioRxiv - Immunology 2019
Quote:
... 4% mouse serum (ImmunoReagents) and 4% goat serum ...
-
No products found
because this supplier's products are not listed.
Huan Peng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 4% chlorhexidine (McKesson Corporation) or 2% acetic acid (Akorn Pharmaceuticals) ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
No products found
because this supplier's products are not listed.
Raquel Garza, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4% buffered formalin (Histo-Lab Products AB ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Lili Qin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... DCs were collected and cocultured with autologous CD8+ T cells with the ratio between 1:4 to 1:10 in AIM-V medium with 5% autologous serum and 30 ng/ml IL-21 (Cellgenix, Germany). Two days later ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Claudia Carlantoni, et al.,
bioRxiv - Developmental Biology 2023
Quote:
24-well Plate Softwell Easy Coat hydrogels of different stiffness (0.1, 1, 2, 4 and 25 kPa, Cat #SS24-EC, Matrigen) were coated with 10µg/ml collagen I rat tail diluted in PBS (Cat #A10483-01 ...
-
No products found
because this supplier's products are not listed.
Augusto Cesar Hunt-Serracin, et al.,
bioRxiv - Microbiology 2019
Quote:
... 4 g of Deoxyribonucleic Acid (Spectrum Chemicals), 5.9 mg diethylene triamine pentaacetic acid (DTPA) ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Jin Gao, et al.,
bioRxiv - Microbiology 2020
Quote:
... Zanamivir and 2’-(4-methylumbelliferyl)-α-d-N-acetylneuraminic acid (MUNANA) were acquired from Moravek Inc and Cayman Chemicals ...
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
Magnetofection
diificult to transfect cells
Cat# KM30400,
SilenceMag 200µL + PolyMag 100µL+ CombiMag 100µL + PolyMag Neo 100µL, USD $338.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Christina Hipfinger, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Samples were prepared by loading the middle cages of 4×4 LEGO scaffolds with VEGF supplemented GelMA microgels and the supplementary peripheral cages with BMP2 (Shenandoah Biotechnology, Inc.) supplemented with GelMA microgels ...
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Liang Qu, et al.,
bioRxiv - Immunology 2022
Quote:
... and NHP IL-4 ELISpot assay kit (U-CyTech). The cryopreserved rhesus macaques PBMCs were thawed and cultured with pre-warmed AIM-V media ...
-
No products found
because this supplier's products are not listed.
Jiechao Zhou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Purified human complement proteins (4 µg/mL, Complement Technology) were immobilized and were treated with His-tagged recombinant neuronal pentraxin proteins (4 µg/mL ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Ahmed S Abdelfattah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at ~1×105 cells per well in 100 μL of a 4:1 mixture of NbActiv4 (BrainBits) and plating medium (28 mM glucose ...
-
No products found
because this supplier's products are not listed.
Sachiko Haga-Yamanaka, et al.,
bioRxiv - Neuroscience 2023
Quote:
... HDAC 4 (50064 and 50076, BPS Bioscience, San Diego, CA), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Vincenzo Davide Aloi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and treated overnight at 4°C with the primary antibody (rabbit anti-pERK; 1:200, PhosphoSolutions). The pre-treated sections were then incubated for 2 hours at room temperature with goat anti-rabbit conjugated to Cy3 ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Primary antibody was applied overnight at 4°C for PDE11A (Fabgennix PD11-101 at 1:500). The following day ...
-
No products found
because this supplier's products are not listed.
Jasper T. Maniates-Selvin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and diamond knife (4 mm, 35° Ultra or Ultra-Maxi, Diatome) were used to cut ultra-thin serial sections (∼45 nm ...
-
No products found
because this supplier's products are not listed.
Jonas N. Conde, et al.,
bioRxiv - Microbiology 2021
Quote:
... hBMECs (passages 4 to 10) were purchased from Cell Biologics (H-6023) and grown in EC basal medium-2 MV (EBM-2 MV ...
-
No products found
because this supplier's products are not listed.
Sachiko Koyama, et al.,
bioRxiv - Physiology 2019
Quote:
... and went through overnight staining at 4°C with anti-BrdU (1:300, rat, Accurate Chemical Co. #OBT0030). On the second day ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The sections were subsequently incubated overnight at 4°C with primary antibodies (S100β 1/200, Sigma S2532; MAP2 1/500, EnCor Biotech CPCA-MAP2 ...
-
No products found
because this supplier's products are not listed.
Cristina Godinho-Silva, et al.,
bioRxiv - Immunology 2019
Quote:
... Whole-mount samples were incubated overnight or for 2 days at 4°C using the following antibodies: anti-Tyrosine hydroxylase (TH) (Pel-Freez Biologicals) and anti-GFP (Aves Labs) ...
-
No products found
because this supplier's products are not listed.
Julian M. Jimenez, et al.,
bioRxiv - Bioengineering 2022
Quote:
Homogeneous fibrin gels were prepared to final fibrinogen concentrations of 2 and 4 mg/mL by combining human fibrinogen (FIB3, Enzyme Research Laboratories) and Alexa Fluor (AF ...
-
No products found
because this supplier's products are not listed.
Benjamin D. Gastfriend, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EZ spheres were passaged every Friday by mechanical dissociation with 2–4 passes on a McIlwain Tissue Chopper (Campden Instruments, Loughborough, United Kingdom), with half of the resulting aggregates returned to the flask and half discarded ...
-
No products found
because this supplier's products are not listed.
Alexandra Tsirigotaki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... were concentrated to 4 mg ml-1 and subjected to crystallization trials using a Mosquito liquid handling robot (TTP Labtech) in sitting drop format with 100 nL protein mixed with 100 nL mother liquor in SwissSci 96-well triple drop plates and incubation at 20°C ...
-
No products found
because this supplier's products are not listed.
Xiaojun Li, Angelika Doetzlhofer,
bioRxiv - Developmental Biology 2020
Quote:
... and expansion medium and plated into pre-warmed 4-well plates (CELLTREAT, no. 229103). For mice stage P2 ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Francesca Murganti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Cells were fixed with 4% formaldehyde solution in PBS for 10 min and stained overnight at 4 °C with primary antibodies against mVenus (1:800, Biorbyt, orb334993) and mCherry (1:250 ...
-
No products found
because this supplier's products are not listed.
Kelly Snead, et al.,
bioRxiv - Biochemistry 2022
Quote:
... at 4°C using 40µL bed volume (BV) nickel-charged IMAC tips (Biotage, Uppsala, Sweden). The columns were washed in a 96-well deepwell plate with 20BV dH2O and then equilibrated in 20BV of 20mM HEPES pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Lazar Novaković, et al.,
bioRxiv - Plant Biology 2022
Quote:
dek1-4 pCESA3:GFP:CESA3 plants were transferred to MS 1% sucrose media supplemented with Plant Preservative Mixture (Plant Cell Technology, Washington DC, USA) diluted in ratio 1:1000 after CESA imaging ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Youwen Zhuang, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cell cultures were grown to a density of 4×106 cells/ mL in ESF 921 serum-free medium (Expression Systems). For the expression of the DRD1-Gs complexes ...
-
No products found
because this supplier's products are not listed.
Xiangyi S. Wang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Ubiquitin transfer from HOIP RBR to the substrate (TAMRA-ubiquitin) was performed on ice and induced by addition of 4 µM fluorescent TAMRA-ubiquitin (LifeSensors SI270T ...