-
No products found
because this supplier's products are not listed.
Tina H. Dao, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-Methyl-1-phenyl-2- pyrazolin-5-one (Edaravone; Millipore 443300) was resuspended in ethanol at 500mM and heated at 65°C for solubilization ...
-
No products found
because this supplier's products are not listed.
Antoine A. Khalil, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2, 6-dioxo-1-propyl-1H-purin-8-yl)-benzenesulfonic acid (PSB1115) (Tocris) (Lin et al. ...
-
No products found
because this supplier's products are not listed.
H. Hendrix, et al.,
bioRxiv - Microbiology 2019
Quote:
... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Paweł Kozielewicz, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Purmorphamine (9-Cyclohexyl-N-[4-(4-morpholinyl)phenyl]-2-(1-naphthalenyloxy)-9H-purin-6-amine) was from Abcam. SAG1.3 (3-Chloro-N-[trans-4-(methylamino)cyclohexyl]-N-[[3-(4-pyridinyl)phenyl]methyl]benzo[b]thiophene-2-carboxamide ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Kai-En Chen, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50 μl of 10 mg/ml stock of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) and 1-palmitoyl-2-oleoyl phosphatidylethanolamine (POPE) in a 9:1 ratio (Avanti Polar Lipids) was freshly prepared in a 500 μl volume and lipid films formed using the same method as Folch liposomes ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Elizabeth Min, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Smad 2/3 (1:1000; Cell Signaling; #8685S), P-Smad 1/5/8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Mark Borris D. Aldonza, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Caspase 3/7 and 9 activities were assessed using a fluorescence-based Apo-ONE homogenous caspase 3/7 assay kit (Promega) and luminescence-based caspase-glo 9 assay system (Promega) ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
Mukaddes Izci, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
Anthony Yan-Tang Wu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... or 3 μL of pelleted fraction 2-9 (duplicates) were added into a 96-well white plate (Greiner Bio-One, Germany). Furimazine (Promega ...
-
No products found
because this supplier's products are not listed.
Darach Miller, Adam Dziulko, Sasha Levy,
bioRxiv - Systems Biology 2024
Quote:
... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Julia Cox, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and 9 Drd1a-tdTomato mice (strain 016204, The Jackson Laboratory; 3 female, 6 male). Mice were between the ages of 2 and 5 months at the beginning of all experiments ...
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
No products found
because this supplier's products are not listed.
Swagatika Paul, et al.,
bioRxiv - Cell Biology 2022
Quote:
... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Erik Ames Burlingame, et al.,
bioRxiv - Systems Biology 2020
Quote:
... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Julia K. Rotow, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and maintained in culture for a total of approximately 2-3 months in DMEM supplemented with 1 ng/mL IL-3 (Peprotech). Mycoplasma testing was not performed ...
-
No products found
because this supplier's products are not listed.
Sebastian Duno-Miranda, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The fluorescence of 3’-O-(N-Methyl-anthraniloyl)-2’-deoxyadenosine-5’-triphosphate (mantATP) (Jena Biosciences) was measured with 290 nm excitation and a 395 nm long-pass emission filter in a stopped-flow apparatus (Applied Photophysics ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Jin-Woong Heo, et al.,
bioRxiv - Physiology 2023
Quote:
... for 2□min and 3% lead citrate (EMS, 22410) for 1□min ...
-
No products found
because this supplier's products are not listed.
Amin Zargar, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... 5-methyl-6-(propan-2-yl)oxan-2-one was synthesized by Enamine (Cincinnati, USA) to greater than 95% purity.
-
No products found
because this supplier's products are not listed.
Yu H. Sun, et al.,
bioRxiv - Genomics 2020
Quote:
... This mixture was aliquoted in 2-3 cryovials (Corning, NY), secured on an aluminum cryocane ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Adam B. Yasunaga, Isaac T.S. Li,
bioRxiv - Biophysics 2021
Quote:
... the coverslips/slides were placed in a 1% aminosilane solution (94 mL methanol, 1 mL 3-(2-aminoethylamino)propyltrimethoxysilane (VWR, CAS# 1760-24-3), 5 mL glacial acetic acid ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
Cat# HY-101412-50 mg,
50 mg, USD $900.0
Ask
Isadora Oliveira Prata, et al.,
bioRxiv - Microbiology 2021
Quote:
1-(2,3-di(Thiophen-2-yl)quinoxalin-6-yl)-3-(2-methoxyethyl)urea (CAS 508186-14-9 – MCE-MedChemExpress) is an Acetyl-CoA Synthetase 2-specific and potent inhibitor ...
-
No products found
because this supplier's products are not listed.
Joseph Chapman, et al.,
bioRxiv - Biochemistry 2019
Quote:
1-methyl-3-nitro-1-nitrosoguanidine (MNNG) was purchased from TCI America and dissolved in DMSO as a 1 M stock ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ...
-
No products found
because this supplier's products are not listed.
Sergio P. Alpuche-Lazcano, et al.,
bioRxiv - Microbiology 2023
Quote:
The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Timothy J. Mottram, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
No products found
because this supplier's products are not listed.
Teun M Klein Gunnewiek, et al.,
bioRxiv - Neuroscience 2019
Quote:
... with medium changes every 2-3 days and passages 1-2 times per week using ReLeSR (Stem Cell Technologies). Heteroplasmy levels were regularly measured to insure they were retained across passage numbers ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Boštjan Kokot, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-(2-aminoethylamino)propyltrimethoxysilane (AEAPMS, Alfa Aesar), lacy carbon film supported by a 300-mesh copper grid (Ted Pella ...
-
No products found
because this supplier's products are not listed.
Reena P. Murmu, et al.,
bioRxiv - Neuroscience 2019
Quote:
A glass micropipette (1–3 MΩ impedance; 2-μm tip; World Precision Instruments) was connected to a pneumatic injector (3–20 PSI ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...