-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Kristen R. Breit, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 11-Hydroxy-Δ9-THC (Cerilliant H-026-1mL), and 11-nor-9-Carboxy-Δ9-THC (Cerilliant T-018-1ML ...
-
No products found
because this supplier's products are not listed.
Paban Kumar Dash, et al.,
bioRxiv - Genomics 2019
Quote:
... The deduced amino acid was determined from the nucleotide sequence using the EditSeq module of Lasergene 5 software package (DNASTAR Inc, USA). The deduced amino acid sequences of five A(H1N1)pdm09 sequenced in this study along with prototype vaccine strain (A/California/07/2009 ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... DNA from two-cell stage mouse embryos was extracted by transferring the embryos one hour and six hours after injection into 5 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Anna E. Boczula, et al.,
bioRxiv - Microbiology 2021
Quote:
... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Tina Pekec, et al.,
bioRxiv - Physiology 2021
Quote:
... then 5 μM FeRhoNox™-1 solution (Goryo Chemical, Inc., Sapporo, Japan) was added and incubated in the dark at 37 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
John H. Klich, et al.,
bioRxiv - Bioengineering 2022
Quote:
... RAFT CTA 2-cyano-2-propyl dodecyl trithiocarbonate (2-CPDT; >97%; Strem Chemicals) was used as received ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Seung Woo Ryu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... An MRE11-specific shRNA (5’ACAGGAGAAGAGAUCAACUUUGuuaauauucauagCAAAGUUGAUCUCUUCUCCUGU-3’) was expressed under doxycyclin control from pRSITEP-U6Tet-(sh)-EF1-TetRep-2A-Puro (Cellecta, Inc.). BacMam constructs were generated from pAceBac1 (Geneva Biotech ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... 5 μl PPP Master Mix (Top-Bio) and 3 μl PCR H2O (Top-Bio) ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
Recombinant AAV-8 VP3 Protein, fused to His-tag, was expressed in E. coli.
Cat# VP3-318A,
10ug , USD $298
Ask
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
A. Florentin, et al.,
bioRxiv - Microbiology 2019
Quote:
... beads using 5 mM BS3 crosslinker (CovaChem) and then incubated with the supernatant at 4°C ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Brigitta M. Laksono, et al.,
bioRxiv - Microbiology 2022
Quote:
... or fluorescein-labeled Sambucus nigra lectin (SNA) (5 μg/ml; EY Laboratories; BA-6802-1), respectively ...
-
No products found
because this supplier's products are not listed.
Benjamin A Nanes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% bovine serum albumin (Equitech-Bio BAH65-0500), and 0.5% Triton X-100 (Sigma X100 ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The established stable cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 4∼5% fetal calf serum (FCS; Thermo Fisher Scientific, or Nichirei Biosciences Inc) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Adam T. Hilterbrand, et al.,
bioRxiv - Microbiology 2021
Quote:
... 250 ug/ml G418 and 5 ug/ml of puromycin (AG Scientific). CHO-nectin-1 cells were a gift from Richard Longnecker (Northwestern University) ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Serial cross sections (5□µm thick) were immunostained with rabbit anti-mouse LYVE1 (1:100) polyclonal antibody (11-034, AngioBio Co). DAB (3,3′ -Diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Li-Ying Yu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cells were grown for 5 days in iCell Neural Base Medium 1+ iCell Neural Supplement B (M1010, M1029, FUJIFILM Cellular Dynamics). Then the cells were treated with 6-OHDA (50 µM ...
-
Cytokeratin 5/8 Antibody is a Mouse Monoclonal against Cytokeratin 5/8.
Cat# abx139683-0.1MG,
0.1 mg USD $319.0
Ask
Davide Piccolo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Cells were first washed with PBS and then incubated for 1 hour and 30 minutes at 5% CO2 and 37°C or 30°C with the primary antibody (Anti-ABCA4 Abbexa abx130549 1:300) diluted in DMEM containing 10% FBS ...
-
No products found
because this supplier's products are not listed.
Susanne Hellmuth, Olaf Stemmann,
bioRxiv - Cell Biology 2024
Quote:
... raised against CAKSKAKPPKGAHVEV = Cys + amino acids 1183-1197 of the human protein) and human anti-CREST (1:1,000; hct-0100, ImmunoVision). Secondary antibodies (all 1:500) ...
-
No products found
because this supplier's products are not listed.
María del Pilar Martínez-Diz, et al.,
bioRxiv - Microbiology 2020
Quote:
... DNA was extracted from 0.5 g of xylem tissue collected between 3- to 8-mm from the pruning wound using the i-genomic Plant DNA Extraction Mini Kit (Intron Biotechnology, South Korea). DNA yields from each sample were quantified using the Invitrogen Qubit 4 Fluorometer with Qubit dsDNA HS Assay (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Ailsa Black, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The supernatant was de-salted on ultra-microspin column silica C18 (The Nest Group). De-salted peptides were dried using a SpeedVac vacuum centrifuge concentrator (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Gemma L. Pearson, et al.,
bioRxiv - Cell Biology 2022
Quote:
... blocked for 1 h at room temperature with 1 X Blocking One solution (Nacalai USA Inc; San Diego, CA, USA). Sections were then incubated in the following primary antisera overnight at 4°C in 1 X PBS + 1% tween + 20% Blocking One solution ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Alessandra Boccaccini, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein extraction for PIF4 N3 (1:3000, Abiocode R2534-4) detection was performed according to Fiorucci et al. ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...
-
No products found
because this supplier's products are not listed.
Jessica Hunter, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... The infection was then separated into infected cells and cell-free virus by centrifugation at 300 g for 5 minutes followed by filtration of the supernatant through a 0.45 micron filter (GVS). 1.2 × 106 infected cells or supernatant from 1.2 × 106 infected cells were added to new uninfected target cells such that the final number of cells in the culture was 6 × 106 at a concentration of 1 × 106cells/ml ...
-
No products found
because this supplier's products are not listed.
Steven Park, et al.,
bioRxiv - Microbiology 2022
Quote:
... Replicators with 96 one-millimeter pins (Boekel Industries # 140500) were sterilized in an autoclave before the start of the experiment and with an open flame between the transfer steps ...
-
No products found
because this supplier's products are not listed.
Yana Roka-Moiia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5 mM CaCl2) were incubated with 200 nM acetylated prothrombin and 100 pM factor Xa (Enzyme Research Laboratories, South Bend, IN) in 20 mM HEPES buffer (pH 7.4) ...
-
Cat# F101,
USD $80.00/EA
Ask
Suzanne M Johnson, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was centrifuged in 2 tubes to remove cells (300 × g 5 minutes, × 2) and filtered using a double layered 5µm pore nylon Sieve (Fisher Scientific: BioDesign cat 12994257). The supernatant was collected and centrifuged at 2000 × g for 30 minutes and prepared for ISX analysis ...
-
No products found
because this supplier's products are not listed.
Le Xu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Primary antibodies with final concentrations used for immunofluorescence staining: rabbit anti-SCGB1A1 polyclonal antibody [5 mg/ml] (WRAB-3950, Seven Hills Bioreagents), mouse anti-FOXJ1 monoclonal antibody [8 mg/ml] (14-9965-80 ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Franziska Herster, et al.,
bioRxiv - Immunology 2019
Quote:
... 4 μg/g of anti-CD42b (clone R300, Emfret Analytics) or rat IgG isotype control (clone R301 ...
-
No products found
because this supplier's products are not listed.
Mathieu Métivier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... dialyzed overnight in PBS at 4°C and used for guinea pig immunization (Covalab).
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...