-
No products found
because this supplier's products are not listed.
Alessandro Gori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The detector antibody (biotinylated CD9, CD63, CD81 antibodies by Ancell or anti-band 3 from Santa Cruz) solutions (0.3 µg/ml ...
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
William Finnigan, et al.,
bioRxiv - Bioengineering 2020
Quote:
N-R7-C at 300 mg/mL was extruded using a syringe pump through a pre-pulled glass capillary (MGM-3-1.5-5NF, 30 μm tip, FivePhoton Biochemicals) at 0.5 mL/h using a syringe pump (Cole-Palmer 74900 series ...
-
No products found
because this supplier's products are not listed.
Maia Moog, Scott C. Baraban,
bioRxiv - Neuroscience 2022
Quote:
... were amplified at a gain of 20x and filtered at 1 kHz (−3 dB; eight-pole Bessel; Cygnus Technology, Inc.), digitized at 10 kHz using a Digidata 1320 A/D interface (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Aleksei Kuznetsov, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and SARS-CoV-2 Spike protein S1 (Icosagen OÜ, Estonia, cat# P-305-100) were used in this study.
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Kei Jokura, et al.,
bioRxiv - Neuroscience 2023
Quote:
... COS-7 cells (Angio-proteomie, CAT no. cAP-0203) with a low endogenous level of soluble guanylate cyclase activity were used ...
-
No products found
because this supplier's products are not listed.
Ortal Iancu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... using combinations of 4 primers for Vγ and 3 primers for Jγ regions in each reaction (IdentiClone™ TCRG Gene Clonality Assay, Invivoscribe, Inc.). TRG clonality was ran and analyzed on 2% agarose gel ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
This product is a recombinant mouse anti-HIV-1 monoclonal antibody. 10-G-9 specifically binds to...
Cat# MRO-2910CQ,
Inquiry
Ask
Christopher J. Minteer, et al.,
bioRxiv - Cancer Biology 2022
Quote:
3 primary human astrocyte cell lines were derived from the cerebral cortex of one 21-year-old male donor (Creative Biolabs, #NCL-2103-P104). The 21M donor was split into Astro1 ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from each cornea were seeded equally across 2 wells of a 24-well plate coated with fibronectin collagen (FNC) coating mix (Athena Enzyme Systems) in M5 stabilization media (human endothelial SFM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Jonathan M Budzik, et al.,
bioRxiv - Microbiology 2019
Quote:
Immunostaining for LC3 was performed with blocking and permeabilization buffer (0.3% Triton X-100, 2% bovine serum albumin) and anti-LC3 (clone 2G6, Nanotools #0260-100/LC3-2G6) at a dilution of 1:200 for 3 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... day 0 and day 21) with 5 μg/dose of recombinant SARS-CoV-2 Spike protein (S1+S2 extracellular domain) (Bon Opus Biosciences, #BP040) adjuvanted with 100 μg/dose alhydrogel adjuvant 2% (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Gareth T. Banks, et al.,
bioRxiv - Neuroscience 2020
Quote:
... group housed mice were tagged with RFID micochips at 9 weeks of age and placed in the Home Cage Analysis system (Actual Analytics, Edinburgh) which captured mouse behaviour using both video tracking and location-tracking using RFID co-ordinates.
-
No products found
because this supplier's products are not listed.
Ken Shirato, Jun Takanari, Takako Kizaki,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... the cells were co-treated with the indicated concentrations of ETAS®50 or dextrin and 100 ng/mL of SARS-CoV-2 spike recombinant protein S1 subunit (Arigo Biolaboratories, Hsinchu City, Taiwan) for 1 to 24 h ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
M. M. Cooley, et al.,
bioRxiv - Pathology 2020
Quote:
... Acini were incubated in salt-balanced HEPES buffer with or without CCK-8 (Research Plus) as indicated at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
A Castellanos-Gonzalez, et al.,
bioRxiv - Microbiology 2022
Quote:
Human ileocecal cells (HCT-8 cells, ATCC, Manassas, VA) and Cryptosporidium parvum parasites (Waterborne, INC, New Orleans, LA) were used for in vitro studies ...
-
No products found
because this supplier's products are not listed.
Asuka Hirooka, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... a 10-amino acid-peptide called NMC or GRP-10 (AssayPro, St. Charles, MO, USA) for 48 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Migmar Tsamchoe, et al.,
bioRxiv - Cell Biology 2022
Quote:
... at 12,000 x g for 25mins and filtered using a 0.22μm filter (Ultident Scientific; Cat#229747). This was then followed by two sequential ultracentrifugation’s (Beckman Coulter ...
-
No products found
because this supplier's products are not listed.
Marlene Corbet, et al.,
bioRxiv - Pathology 2020
Quote:
... male DBA/1 mice (8-weeks old) were injected intradermally on day 0 with 100 µg Bovine Type II collagen (CII; MD biosciences) in complete Freunds adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Jorge Madrid, et al.,
bioRxiv - Physiology 2021
Quote:
... fish weight (g) and length (cm) were evaluated weekly using a scale (Adam Equipment, model HCB 1002, USA) and an ichthyometer (Aquatic Eco - Sistems ...
-
No products found
because this supplier's products are not listed.
Audrey Montigny, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Primary antibodies used for western were: rabbit anti-miPEP-8 were raised against the sequence KQSDKQNSKERKKNTQI (generated and affinity purified by Agro-bio, France), mouse anti-GAPDH (ThermoFisher AM4300) ...
-
No products found
because this supplier's products are not listed.
Ming Yang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-total Rac1 (1:10; NewEast Biosciences); mouse anti-CD44 (1:100 ...
-
No products found
because this supplier's products are not listed.
Jianmei ZHANG, et al.,
bioRxiv - Microbiology 2019
Quote:
... supplement with 10% FBS (Crystalgen, New York, USA), 1×107 cells/well were seeded in 6 well plates and incubated at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Elisa S. Grassi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary Human Astrocytes (3H Biomedical Cat# 1800-10) were cultured in Human Astrocyte Medium #SC1801 (3H Biomedical ...
-
No products found
because this supplier's products are not listed.
Michal Nemergut, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were vortexed (10 s, 2000 rpm, VELP Scientifica), homogenized (4 m/s ...
-
No products found
because this supplier's products are not listed.
Lei Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... medium with 10 µL GeneTran III reagent (GT2211, Biomiga) in 6 cm2 cell culture dishes.
-
No products found
because this supplier's products are not listed.
Nathan M. Belliveau, et al.,
bioRxiv - Cell Biology 2022
Quote:
... resuspended in 10 mL PolymorphPrep (Cosmo Bio USA #AXS1114683) and added to the bottom of a 50 mL conical tube ...
-
No products found
because this supplier's products are not listed.
Raza Ali Naqvi, Araceli Valverde, Afsar Naqvi,
bioRxiv - Immunology 2023
Quote:
... Gene expression was examined using PCR array plate containing 88 primer sets directed against human NF-κB pathway genes and 8 housekeeping primer sets (Real Time Primers, LLC Elkins Park, PA). Briefly ...
-
No products found
because this supplier's products are not listed.
Yann-Ru Lou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1:1 v/v) and loaded to the silica gel column (100 g, 200-425 mesh, 60 A, Jade Scientific Inc, Westland, MI, USA) packed with ethyl acetate/hexane (200 mL ...
-
No products found
because this supplier's products are not listed.
Iñigo Landa, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... after which cells were spun down and resuspended in Coon’s modified F12 medium with penicillin/streptomycin/L-glutamine (P/S/G; Gemini; #400-110) and 0.5% bovine brain extract (BBE, Hammond Cell Tech, cat. #2007-NZ), plated into CellBind plates (Corning Inc. ...
-
No products found
because this supplier's products are not listed.
Benjamin R. Duewell, et al.,
bioRxiv - Biochemistry 2023
Quote:
... by clarifying with a centrifugation step at 4°C for 30 minutes at 21370 x g before passing through 0.22 μm syringe filtration unit (0.22 μm PES syringe filter (Foxx Life Sciences, Cat#381-2116-OEM). We then blocked membrane defects with 1 mg/mL beta casein (Thermo FisherSci ...
-
No products found
because this supplier's products are not listed.
Rupashree Dass, et al.,
bioRxiv - Biophysics 2021
Quote:
... 10 mg 13C/15N-labelled α-synuclein (Giotto Biotech, Sesto Fiorentino, Italy) was dissolved in 550 μl 25 mM Tris buffer pH 9 ...
-
No products found
because this supplier's products are not listed.
Marion Le Gall, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... supplemented with 10% fetal calf serum and 1% ZellShield™ (Minerva Biolabs, Germany), at 37°C in a 5% CO2 incubator.
-
No products found
because this supplier's products are not listed.
Kazuya Matsuo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Human frozen brain sections (5–10 μm thickness) were obtained from BioChain Institute and a part of them were treated with RNase A ...