-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Glennis A. Logsdon, et al.,
bioRxiv - Genomics 2020
Quote:
... and then incubated with a mouse monoclonal anti-CENP-A antibody (1:200, Enzo, ADI-KAM-CC006-E) and rabbit monoclonal anti-5-methylcytosine antibody (1:200, RevMAb, RM231) for 3 h at room temperature ...
-
No products found
because this supplier's products are not listed.
S. Hong Chan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5’ Gppp- cap and 5’ m7Gppp- cap are synthesized by Bio-synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Mark A. Skylar-Scott, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5 μM SB431542 (BioGems, #3014193), and 100 nM LDN193189 (BioGems ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Edouard Leveque, et al.,
bioRxiv - Immunology 2021
Quote:
Colonic sections (5 µm) were saturated with PBS 1% BSA and then incubated with rabbit anti-CD3 (Clone SP7, Diagnostic BioSystems) monoclonal antibody (mAb ...
-
No products found
because this supplier's products are not listed.
Kathleen N. Brown, et al.,
bioRxiv - Pathology 2023
Quote:
... and the cells were resuspended in ~500 μL 1% FBS in PBS and transferred to polystyrene 5 ml flow cytometry tubes (MTC Bio). The samples were placed on ice and protected from light until flow cytometry could be performed ...
-
No products found
because this supplier's products are not listed.
Tobie D. Lee, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... R-5 cells were incubated in a similar fashion except 5 μM pheophorbide A (PhA, Frontier Scientific, Logan, UT) was used as the substrate and 10 μM fumitremorgin C (FTC ...
-
No products found
because this supplier's products are not listed.
Ranmal A. Samarasinghe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Papain was resuspended in 5 ml Hibernate E medium (Brainbits, #HE) containing N2 and B27 supplements (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Hsiao-Jou Cortina Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... filtered and incubated with 5 mL PureCube Ni-NTA agarose (Cube Biotech) for 1 h at 21°C ...
-
No products found
because this supplier's products are not listed.
Gregory J. Smith, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
PBS or clodronate (5 mg/ml) containing liposomes (Liposoma, Amsterdam, The Netherlands) were administered to mice by oropharyngeal aspiration on day 5 of the ozone exposure protocol ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific, cat.no. GR5MM). Counts of nucleated cells was performed using a NIHOKODEN auto blood cell counter under Pre-dilute 20 µl mode ...
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...
-
No products found
because this supplier's products are not listed.
Tim Nierhaus, et al.,
bioRxiv - Microbiology 2021
Quote:
... drops were pipetted up and down 5 times by the Mosquito robot (TTP Labtech) to minimise diffusion effects ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
Cat# H1G028,
USD $125.0/pack
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-UL44 mAb (Virusys Corporation, #P1202-1; 1:100); α-pp65 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Teodor E. Yordanov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Sodium Hyaluronate (1-1.8MDa) (Lifecore Biomedical; HA15M-1), Hyaluronidase from Streptomyces hyalurolyticus (Sigma Aldrich ...
-
Cat# F101,
USD $80.00/EA
Ask
Matthew G. Blango, et al.,
bioRxiv - Microbiology 2021
Quote:
... coli antisera (1:2,000 or 1:5000; BioDesign International).
-
No products found
because this supplier's products are not listed.
Guangyi Luo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... rabbit anti-PFK-1 (1:1000, Zen-bio, China), rabbit anti-GP (1:2000 ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Alternating tangential flow was set to 0.11 L/min (5 L/m2/min) using an XCell Lab Controller (Repligen). The desired rate of medium exchange was achieved by controlling the flow rate of the permeate (spent medium ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Chandra K. Maharjan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... frozen plasma was thawed on ice and 5 uL/sample loaded in duplicate wells onto a 96 well plate in Mouse Ultrasensitive Insulin ELISA kit from ALPCO® ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... Jo-1 (Immunovision, JO1-3000) at 0.05 units/well ...
-
No products found
because this supplier's products are not listed.
J Paes de Faria, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Gapdh (HyTest, #6C5, 1:50,000), Tubulin (Sigma ...
-
No products found
because this supplier's products are not listed.
Waja Wegner, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The white light was spectrally filtered for green light with a bandpass filter (BP1, BrightLine HC 520/5, Semrock, IDEX Health & Science, Rochester, NY) for selective excitation of EYFP or Citrine at 520 nm (Exc2 ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thomas Keating, et al.,
bioRxiv - Immunology 2021
Quote:
... 1:500 mouse anti-human C1q (Quidel) or 1:100 mouse anti-human Ficolin-3 (Hycult ...
-
No products found
because this supplier's products are not listed.
Oluwaseun M. Ajayi, et al.,
bioRxiv - Physiology 2022
Quote:
... Mosquito eggs were produced from 4-5 weeks old females through artificial feeding (Hemotek, Blackburn, United Kingdom) with chicken or rabbit blood (Pel-Freez Biologicals, Rogers, AZ, USA). Upon egg hatching ...
-
No products found
because this supplier's products are not listed.
Thorben Schramm, Vanessa Pahl, Hannes Link,
bioRxiv - Systems Biology 2023
Quote:
... covered with Breathe-Easy (Diversified Biotech BEM-1) adhesive membrane ...
-
No products found
because this supplier's products are not listed.
Natasha D. Durham, et al.,
bioRxiv - Microbiology 2019
Quote:
... developed for 20 min with 50 µl/well SciColor T12 (Cat# CD-5600-100; Scienion AG), then analyzed using sciREADER CL2 (Scienion AG) ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Valérie Clavet-Fournier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The ACSF solution was continuously infused with 5 % CO2 and delivered with a flow of ∼1 ml/min (MINIPULS 3 Peristaltic Pump, Gilson).
-
No products found
because this supplier's products are not listed.
Erika Ganda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5 mL of sterile water and 5 mL of 100% ethanol (Decon Labs, King of Prussia, PA) were added to the tube and the pellet was resuspended by vortexing ...
-
No products found
because this supplier's products are not listed.
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... resuspended proteins were PEGylated for 1 hr at RT to label newly exposed cysteine thiols with the 5 kDa mass tag reagent (mPEG-5k, Badrilla SiteCounter™). Approximately 20 μl of each supernatant was saved as the “total input.” For immunoblot analysis ...
-
Recombinant HTLV-1 gp46 protein, fused to His-tag, was expressed in HEK293.
Cat# GB46-01VH,
50ug , USD $298
Ask
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lukas Spiller, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 nmol CpG (TIB MOLBIOL, Berlin, Germany), and an equal volume of Incomplete Freund’s adjuvant (IFA ...
-
4A/4B, Peptide (1) is a peptide.
Cat# abx266389-10MG,
10 mg USD $565.5
Ask
Davide Piccolo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Cells were first washed with PBS and then incubated for 1 hour and 30 minutes at 5% CO2 and 37°C or 30°C with the primary antibody (Anti-ABCA4 Abbexa abx130549 1:300) diluted in DMEM containing 10% FBS ...
-
Cat# 254757-21-6,
Inquire
Ask
Harikiran Nistala, et al.,
bioRxiv - Genetics 2020
Quote:
... and sodium tetraphosphate (P4, BOC Sciences 7727-67-5) was determined by a fixed time assay using BIOMOL GREEN phosphate detection kit (BML-AK111 ...
-
No products found
because this supplier's products are not listed.
Maria Kuzikov, et al.,
bioRxiv - Molecular Biology 2023
Quote:
5 µl/ 100 nM of USP7/USP14 (BPS bioscience, #80364) were added to assay plates containing the compounds ...
-
No products found
because this supplier's products are not listed.
Yara Eid Mutlak, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Phospho-Serine antibody was from ECM biosciences (Cat# PP2551, lot# 5). Anti-Laminin (Cat# L9393 ...
-
No products found
because this supplier's products are not listed.
Mengmeng Jin, et al.,
bioRxiv - Neuroscience 2024
Quote:
... cells were passaged every 4∼5 days with Accutase (Innovative Cell Technologies) onto Matrigel (BD Biosciences)-coated culture plates at a ratio of 1:4∼1:8 supplemented with ROCK inhibitor Y-27632 (10 mM ...
-
No products found
because this supplier's products are not listed.
Alasdair TM Hubbard, et al.,
bioRxiv - Microbiology 2019
Quote:
... at 5 × 105 cells per ml in CnT-Prime medium (CnT-PR, CELLnTEC, Switzerland). An appropriate amount of CnT-PR was added to the basolateral chamber of the inserts so that the medium levels were equal ...
-
No products found
because this supplier's products are not listed.
DT Dinh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
CBAF1 female mice were stimulated with 5 IU eCG (Lee BioSolutions, Maryland Heights, USA) and culled at 44 hours post-eCG ...
-
No products found
because this supplier's products are not listed.
Scott C. Bolton, et al.,
bioRxiv - Biochemistry 2023
Quote:
... the culture was supplemented with 10 mL (5%) Boost Production Additive (Expression Systems LLC, Davis, CA) where indicated ...
-
No products found
because this supplier's products are not listed.
Irene P. Ayuso-Jimeno, et al.,
bioRxiv - Neuroscience 2021
Quote:
Mice were anesthetized with 5% isoflurane and subsequently head fixed in a stereotaxic frame (RWD Life Science) with body temperature maintained at 37 °C ...
-
No products found
because this supplier's products are not listed.
Sithurandi Ubeysinghe, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A 25 µL aliquot was pipetted from the cell suspension into a 4×5 mm glass cylinder (7030304; Bioptechs) fixed on a glass bottom dish with high-temperature silicon grease ...
-
No products found
because this supplier's products are not listed.
Wenyang Yi, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sheep anti VSX2 (1:400, Exalpha Biologicals), Sheep anti ONECUT2 (1:40 ...