-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2-axis computer-controlled stepping motor system (4”× 3” XY; Prior Scientific, Jena, Germany), focus encoder (Heidenhain ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Emily H. Adhikari, et al.,
bioRxiv - Immunology 2023
Quote:
... plates were incubated overnight at 4°C with primary antibody (1:5,000 anti-SARS-CoV-2 alpaca serum) (Capralogics Inc) (126) ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals). Non-phosphorylated Ub protein (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Yuichi Shichino, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and then incubated with 150 μl of FLAG elution buffer (FLAG wash buffer 2 with 1 mg/ml 3×FLAG peptide [Protein Ark, GEN-3XFLAG-25]) overnight ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Immunofluorescent staining of either differentiating cells in ALI wells or of the paraffin embedded human bronchus from healthy nonsmokers (Donor 1: Age 27, Female; Donor 2: Age 40, Female and Donor 3: Age 27, Female; catalog number HuFPT111, US Biomax, Inc., Rockville, MD, USA), or mouse trachea (C57BL/6 ...
-
No products found
because this supplier's products are not listed.
Saba Goodarzi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... separated by a 1 mm sticky spacer (2×0.5mm thick Ispacer, SunJin Lab).
-
No products found
because this supplier's products are not listed.
Fei Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-GAPDH antibody (catalog # 2-RGM2, Advanced ImmunoChemical) was used at 1 μg/mL.
-
No products found
because this supplier's products are not listed.
Flávia Viana, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10-4 and 10-6 were automatically plated using easySpiral® automatic plater (Interscience, France) in triplicates on BCYE agar ...
-
No products found
because this supplier's products are not listed.
Juan Feng, et al.,
bioRxiv - Immunology 2021
Quote:
Heavy and light chain V region cDNA sequences of mAbs 2/6.14 and 2/1.12 were determined by Syd Labs (Natick, MA). The mAbs each have γ1 heavy and κ light chains and unique V regions as shown by BLAST searches ...
-
No products found
because this supplier's products are not listed.
Sangam Kandel, et al.,
bioRxiv - Genomics 2023
Quote:
... Samples were tested for the SARS-CoV-2 using the Aptima® SARS-CoV-2 (Panther® System, Hologic, San Diego, CA) nucleic acid amplification assay ...
-
No products found
because this supplier's products are not listed.
Hironobu Endo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... desmethyl precursor of 11C-PBB3 (Nard Institute, NP076-2), desmethyl precursor of 11C-PE2I (Nard Institute ...
-
No products found
because this supplier's products are not listed.
Bryana N. Harris, et al.,
bioRxiv - Systems Biology 2022
Quote:
Cardiac myocytes were isolated from 1-2-day-old Sprague-Dawley rats using a Neomyt isolation kit (Cellutron, USA). The cells were cultured in plating media (low-glucose Dulbecco’s modified eagle media (DMEM) ...
-
No products found
because this supplier's products are not listed.
Kevin S. Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 250 μL of wounded cells was ejected from the guillotine device and the outlet tubing using a syringe pump (see details in Section 5.3) into 1 mL of the fixing solution in a 2 mL round-bottomed tube (111568, Globe Scientific) and incubated for 10 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
Carbohydrate
Cat# GMS0393S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... version 6 (DNAStar). Consensus sequences were derived from at least two independent forward and reverse sequences ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Thomas Rowe, et al.,
bioRxiv - Microbiology 2024
Quote:
... 180 uL of HEK-λ cells were added to each well containing twenty uL of sample and to serially 1/2-log diluted (0.1 – 1000 ng/mL) recombinant ferret IFNL3 (Kingfisher Biotech, St. Paul, MN, USA). The plates were incubated for 20Hr at 37°C ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
No products found
because this supplier's products are not listed.
Jessica Hoff, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 U mL-1 DY-636 conjugated Phalloidin (Dyomics) for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... (6) was purchased from GenTarget Inc.
-
No products found
because this supplier's products are not listed.
S Ghoroghi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 2 ml of concentrated extracellular medium were applied on top of a qEV column (Izon Science) and 6 ml fractions were collected ...
-
No products found
because this supplier's products are not listed.
Gabriel Brawerman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... aliquots of the low and high glucose supernatants and the insulin content extracts were collected and spun at 3000g for 5 minutes at 4°C and stored at −20°C or used immediately for mouse or human insulin ELISAs (Mercodia) with appropriate dilutions (1:10-1:50 for supernatants ...
-
No products found
because this supplier's products are not listed.
Chao Zhai, et al.,
bioRxiv - Cell Biology 2022
Quote:
... every four carriers containing samples were put into a 2 mL polypropylene tube (BIOLOGIX, lot #81-0204) containing 1 ml substitution solution ...
-
No products found
because this supplier's products are not listed.
Homa Majd, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Full-thickness tissues pieces (∼2 cm2) were fixed overnight (<24 hours) in 10% neutral buffered formalin (Cancer Diagnostics, FX1003). Samples were transferred to 70% ethanol prior to paraffin embedding (Leica ASP6025 ...
-
No products found
because this supplier's products are not listed.
Elisa M Nabel, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were anesthetized with 2% isoflurane and head-fixed on in a mouse stereotactic apparatus (Narishige International USA Inc.) equipped with a heating pad ...
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... approximately 2×107 fungal cells were incubated with human kininogen (10 μg/ml; Molecular Innovations, Inc., Cat. # HK-TC) and/or human vitronectin (30 μg/ml ...
-
No products found
because this supplier's products are not listed.
Ben J. G. Sutherland, et al.,
bioRxiv - Genetics 2020
Quote:
... was conducted using the HAT-F/HAT and NAT collections in Table 2 combined by source type (HAT-F/HAT vs. NAT) as a multi-locus genotype-environment association (GEA) using vegan v2.5-5 (Oksanen et al. ...
-
No products found
because this supplier's products are not listed.
Chih-Jen Cheng, et al.,
bioRxiv - Physiology 2024
Quote:
... age- and gender-match littermates were anesthetized with 2% isoflurane and underwent osmotic minipump (Alzet model 1002, Durect, CA, USA) implantation subcutaneously into the neck ...
-
No products found
because this supplier's products are not listed.
Jan D. Beck, et al.,
bioRxiv - Immunology 2023
Quote:
... and 60 mg/kg 5-fluorouracil (5-FU) (Medac) in 0.9% NaCl (Braun ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Glennis A. Logsdon, et al.,
bioRxiv - Genomics 2020
Quote:
... and then incubated with a mouse monoclonal anti-CENP-A antibody (1:200, Enzo, ADI-KAM-CC006-E) and rabbit monoclonal anti-5-methylcytosine antibody (1:200, RevMAb, RM231) for 3 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Mariano R. Rodríguez-Sosa, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Ad-MSC were incubated for 30 min with 1/3 dilution of Propidium Iodide (PI) solution (Cytognos, Spain) in PBS 1X ...
-
No products found
because this supplier's products are not listed.
Jessica Trinh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... water was replaced with 500 μL of either water or water containing MAMP before pressure-infiltrating for 2 minutes at 30 mm Hg in a vacuum desiccator (SP Bel-Art #F42025-0000). Leaf disks were collected at 0 ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Pranjali Beri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The uncured LSR was vulcanized at 150°C for 2 minutes using a hydraulic lab press equipped with heated platens (Carver Bench Top Auto Press) then demolded from the tool.
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Lucas Ferguson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... from 6 mL of polysome buffered 10% (w/v) D-sucrose and 6 mL of polysome buffered 50% D-sucrose solution using the Gradient Master (BioComp Instruments). Using a wide-bore pipette tip ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
Cells were seeded (3×105) in 35 mm glass-bottom dishes (WillCo Wells BV, Amsterdam, The Netherlands) with 2 ml of culture medium and maintained at 37°C and 5% CO2 for 24 prior to transfection (vide infra ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-JFH-1 NS5A (clone 7B5, BioFront Technologies, 1:10,000). Blots were incubated for 1 hour with HRP-conjugated secondary antibodies diluted in 5% skim milk ...