-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the N-terminal tag was removed by incubation with HRV 3C protease (AG Scientific) and further purified by Superose 6 column ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Hassan E. Eldesouky, et al.,
bioRxiv - Microbiology 2019
Quote:
... and 6-Gingerol were obtained from Ark Pharm (Arlington Heights, IL). Atorvastatin was obtained from Selleckchem (Radnor ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interleukin 6 (IL6) ELISA Kit (RD-IL6-Mu, Reddot biotech), Mouse Interferon Gamma Induced Protein 10kDa (IP10 ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Jin Gao, et al.,
bioRxiv - Microbiology 2020
Quote:
... Zanamivir and 2’-(4-methylumbelliferyl)-α-d-N-acetylneuraminic acid (MUNANA) were acquired from Moravek Inc and Cayman Chemicals ...
-
No products found
because this supplier's products are not listed.
Matthew J. Foulkes, et al.,
bioRxiv - Immunology 2019
Quote:
... The c-Jun N-terminal kinase inhibitor SP600125 was obtained from StressMarq Biosciences (Victoria, Canada), and tanshinone IIA (TIIA ...
-
No products found
because this supplier's products are not listed.
Alex M. Eddie, et al.,
bioRxiv - Immunology 2021
Quote:
... in a 6-well cell culture plate (Peak Serum Inc. Cat. #TR5000), supplemented with recombinant mouse BAFF (10 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Michel Engeln, et al.,
bioRxiv - Neuroscience 2019
Quote:
... mice were injected with 0.5mg/kg clozapine-N-oxide (i.p.; LKT Laboratories, St. Paul, MN, USA) 30 min prior to behavioral testing.
-
No products found
because this supplier's products are not listed.
Marina Chan, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Recombinant purified N-terminal domain (NTD) of the SARS-CoV-2 was obtained from Leinco Technologies Inc (Cat #S853 ...
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Carole Y. Perrot, et al.,
bioRxiv - Immunology 2023
Quote:
... immersed in a pH=6 antigen retrieval solution (IHC World, Elliott City, MD) and placed in a steamer for 40 min at 95-98°C ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
The serum progesterone levels (n=4) were measured using an ELISA assay (# K025-H1/H5 Arbor Assays, Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Vanessa M. Doulames, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a subset of rats (n=10) were retrograde traced with Fluorogold (Fluorochrome, 2% solution in sterile distilled H2O). Briefly ...
-
No products found
because this supplier's products are not listed.
Maria Calvo-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and incubated with target antibodies at 4C o/n (GFP (1:500, Antibodies Incorporated Cat# GFP-1020, RRID:AB_10000240), HSP60 (1:200 ...
-
No products found
because this supplier's products are not listed.
Chen Liu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... was labeled with 5′-801 carboxytetramethylrhodamine at the N-terminus (TAMRA-PEP1) with an HPLC purity of 95.24% and molecular weight of 2905.24 (EZBiolab). The peptide was dissolved in water to obtain 1 mM peptide stocks ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Vignesh Jayarajan, et al.,
bioRxiv - Cell Biology 2022
Quote:
The ROCKi inhibitor Y-27632 ((R)-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide-2) was purchased from AdooQ Bioscience (#A1101 ...
-
No products found
because this supplier's products are not listed.
Daniel Roderer, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... were immobilized on commercial N-hydroxysuccinimide (NHS) ester-activated microarray slides (CodeLink Activated Slides; SurModics, Eden Prairie, MN, USA) using a piezoelectric spotting device (S3 ...
-
No products found
because this supplier's products are not listed.
Dewi Safitri, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... HEK293T cells overexpressing full-length GIPR or GLP-1R with an N-terminal FLAG tag were purchased from Multispan, Inc (Hayward ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Anurag Pandey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anaesthetised mice were secured in a Narishige SR-6 stereotaxic frame (Narishige International, London, UK); the skull was thinned over a 2 x 2mm area above the barrel-field centerd on the D1 barrel (at approximately 3mm lateral to the midline and 1.5 mm caudal to bregma) ...
-
No products found
because this supplier's products are not listed.
Kishor Dnyaneshwar Ingole, et al.,
bioRxiv - Plant Biology 2020
Quote:
... cDNAs of SUM1AA or SUM3AA were cloned as EcoRI-SalI fragment into pASK-IBA16 vector (N-terminal Strep-tag II affinity tag; Neuromics). For in vitro isoform influence on SUMOylation assays SUM1GG or SUM3GG were cloned as EcoRI-SalI fragment into pASK-IBA16 vector ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Koichi Sato, Aiko G.M. Hendrikx, Puck Knipscheer,
bioRxiv - Biochemistry 2023
Quote:
... The wild-type protein was overexpressed as a N-terminal His6-tagged protein in the E.coli JM109(DE3) cells (Intact Genomics) cultured in 4.4 L LB medium and purified by the previously described method53 ...
-
No products found
because this supplier's products are not listed.
Emmanuela Adjei-Sowah, et al.,
bioRxiv - Bioengineering 2023
Quote:
... GPC measurements were performed on a Shimadzu 20A GPC system equipped with a TSKgel SuperHM-N and complementary guard columns from Tosoh Bioscience ...
-
No products found
because this supplier's products are not listed.
Yu Han, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Fetal heart and postnatal hearts (n=5 each) were acquired commercially at E17.5 and P1 from Zyagen (San Diego, CA), weighed ...
-
No products found
because this supplier's products are not listed.
Noel M. Lacerna II, et al.,
bioRxiv - Microbiology 2020
Quote:
... (±) trans-12,13-Epoxy-octadecanoic acid (6) and 12(Z)-octadecenoic acid (7) were purchased from Larodan Fine Chemicals (Solna ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Tawna L. Mangosh, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Hybridization with 333ng/mL of a TelC-Cy5-labeled peptide nucleic acid (PNA) oligonucleotide telomere probe (N-CCTAACCTAACCTAA-C, PNA BIO) in PNA buffer (10mM Tris pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Joshua A. Beitchman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A single-barreled glass capillary with a filament (1.0 × 0.58 mm2, 6” A-M Systems, Inc., WA) was pulled to a tip using a Kopf Pipette Puller (David Kopf Instruments ...
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
Samples were screened for IgG to SARS-CoV-2 N protein using a commercially available kit (Epitope Diagnostics Inc, San Diego, USA) as previously described (8).
-
No products found
because this supplier's products are not listed.
Boyang Zhao, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and σNS-ΔN17 were subcloned into the bacterial expression vector pET28 with an N-terminal His tag and a TEV protease cleavage site (Epoch Life Science). Escherichia coli DE3 cells (Novagen ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Danielle L. Michell, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Bone marrow cells were isolated from wild-type C57BL/6 mouse femurs and differentiated to bone marrow-derived macrophages (BMDM) using murine GM-CSF (50ng/mL, Tonbo Biosciences) in DMEM (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Steven D. De Michino, et al.,
bioRxiv - Genomics 2023
Quote:
... a predetermined quantity (10-300 ng SU-DHL-6 cfDNA) was diluted in RPMI 1640 (Wisent Bioproducts, CAT #350-000-CL) and subjected to ChIP-Seq adapted from Sadeh et al21 ...
-
No products found
because this supplier's products are not listed.
Alena Rudkouskaya, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The excitation was set to 750 nm, and the emission filter were 820±6 nm (Semrock, FF01-820/12-25) and 810±45 (Chroma Technology, ET810/90). The imaging parameters were set the same for all mice.
-
No products found
because this supplier's products are not listed.
Neeltje van Doremalen, et al.,
bioRxiv - Microbiology 2021
Quote:
... Tissues were processed using a VIP-6 Tissue Tek, (Sakura Finetek, USA) tissue processor and embedded in Ultraffin paraffin polymer (Cancer Diagnostics, Durham, NC). Samples were sectioned at 5 µm ...