-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
Cat# H2G029,
USD $125.0/pack
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
No products found
because this supplier's products are not listed.
Hiroki Miyahara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and stained with 4ʹ ,6-diamidino-2-phenylindole (DAPI) for 10 min prior to mounting in FluoromountTM (K024, Diagnostic BioSystems, California, USA). Samples for ThT staining were treated with 1% ThT for 3 min and differentiated in 1% acetic acid for 15 min ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Hyunjoon Kim, Soohyun Jang, Young-suk Lee,
bioRxiv - Molecular Biology 2021
Quote:
... cells were selected with medium containing 1∼2 μg/ml puromycin (AG Scientific #P-1033) until non-transduced cells became completely dead ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Diego A. Vargas-Blanco, et al.,
bioRxiv - Microbiology 2019
Quote:
... transferred to 2 mL disruption tubes (OPS Diagnostics 100 μm zirconium lysing matrix ...
-
No products found
because this supplier's products are not listed.
Peter M. Masschelin, et al.,
bioRxiv - Physiology 2022
Quote:
... and serum-free fatty acids (#sfa-1; Zen-Bio).
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Wentao Yu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... An optical long-pass filter can be placed before the tube lens to further reduce the backscattered UV light. A custom-built 2-axis angle adjustable platform (Supplementary Fig. 2) under the vibratome (VF-700-0Z, Precisionary Instruments Inc.) ensures the focal plane of the objective lens is parallel with the surface of the sample sectioned by the vibratome ...
-
No products found
because this supplier's products are not listed.
Stanislav Jabinski, et al.,
bioRxiv - Microbiology 2023
Quote:
Medium water samples (2 mL) or CO2 headspace (2 mL) gas were injected into a helium-flushed 12 mL exetainer vials (Exetainer, Labco Limited, UK). Water samples were acidified with 0.1 mL 85% H3PO4 and left to equilibrate for at least 24 hours before measurement ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or IGF2 (5e-2 pM – 5e2 nM; Cell Sciences). Subsequently ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Andrew Chase, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Rabbit anti-FLAG (Signalway Antibody LLC, Maryland, USA; T503-2), tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
Marta Bermejo-Jambrina, et al.,
bioRxiv - Immunology 2023
Quote:
... SARS-CoV-2 pseudovirus productions were quantified by RETRO-TEK HIV-1 p24 ELISA according to manufacturer instructions (ZeptoMetrix Corporation).
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Jorge Antolio Domínguez-Bautista, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 2% bovine serum albumin suitable for cell culture (RMBIO BSA-BAF-25G), and antibiotic/antimycotic (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Giovanni Scarinci, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... and a solution of 0.1 % formic acid 99:1 acetonitrile:water (Honeywell research chemicals) as phase B ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Simon P. Fraessle, et al.,
bioRxiv - Immunology 2022
Quote:
... 2×104 Target cells were seeded into 96 well E-Plate (ACEA Biosciences Inc.) and rested overnight ...
-
No products found
because this supplier's products are not listed.
Bruno Rafael Barboza, et al.,
bioRxiv - Microbiology 2023
Quote:
... and incubated with primary antibodies: mouse anti-cardiac troponin T (HyTest clone 4T19/2) and rabbit anti-α-actinin (Millipore ...
-
No products found
because this supplier's products are not listed.
Telmo A. Catarino, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... or LPS (1:100, WN1 222-5, Hycult Biotech) at 4 ° C ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
J. Graham Ruby, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... Animal cages were changed every 2 weeks within a cage change station (NuAire, Plymouth, MN). Mice were transferred between cages using red transparent acrylic tunnels (Bio-Serv ...
-
No products found
because this supplier's products are not listed.
Alexander Lercher, et al.,
bioRxiv - Immunology 2023
Quote:
Anesthetized mice were intranasally (i.n.) treated with 2×25 µL clodronate liposomes (Liposoma #C-005) 3 days prior to alveolar macrophage transfer ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Corinne A. Tovey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... or anti-sheep secondary antibodies (1:2000 in PSBT + 4% milk powder, ImmunoReagents) as appropriate for 45 mins at room temperature ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Susanne Hellmuth, Olaf Stemmann,
bioRxiv - Cell Biology 2024
Quote:
... raised against CAKSKAKPPKGAHVEV = Cys + amino acids 1183-1197 of the human protein) and human anti-CREST (1:1,000; hct-0100, ImmunoVision). Secondary antibodies (all 1:500) ...
-
No products found
because this supplier's products are not listed.
Alec T Beeve, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and the implant site muscle and skin layers were closed with 5-O Vicryl (Ethicon, J303H) and 4-O Nylon (McKesson, REF S662GX) suture ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
... Nuclei were stained with 5 µM Draq5 (Biostatus Ltd. 1:1000 in PBS). Coverslips were mounted onto microscope slides with a glycerol free poly-(vinyl alcohol ...
-
No products found
because this supplier's products are not listed.
Jamilla Akhund-Zade, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
The MA and FL traps were created by cutting an approximately 2 inch-square flap into an empty one-gallon plastic ethanol jug (Koptec, Decon Labs) and baiting them with a fruit and wine mixture ...
-
No products found
because this supplier's products are not listed.
Niklas Schandry, et al.,
bioRxiv - Plant Biology 2021
Quote:
Individual isolates were pre-cultured in ½ strength TSB medium in 96-Well 2 ml deep-well plates (Semadeni) covered with a Breathe-Easy (Diversified Biotech) membrane until stationary phase for 6 d at 28°C and 180 rpm ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
G. Uppal, et al.,
bioRxiv - Biophysics 2020
Quote:
... The PEG-RGD and 4-arm PEG-acrylate (4-PEG-ACR, 20kDa, JenKem Technology) were mixed at a 1.5:8.5 (w/w ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Serial cross sections (5□µm thick) were immunostained with rabbit anti-mouse LYVE1 (1:100) polyclonal antibody (11-034, AngioBio Co). DAB (3,3′ -Diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...