-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Takashi Furusawa, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... obtained from Cambridge Isotope Laboratory (Andover, MA) as well as 13C6-glucose-6-phosphate and 13C6-fructose-1,6-diphosphate purchased from Medical Isotopes, Inc ...
-
Cat# H6K243,
USD $495.0/kit
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Cian Schmitt-Ulms, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Cypridina Luciferase Assay reagent (Targeting Systems, VLAR-2) respectively ...
-
Coenzyme A Assay Kit
Cat# ECOA-100,
1.0 kit, 100 tests, USD $349.0
Ask
Amanda P. Waller, et al.,
bioRxiv - Pathology 2020
Quote:
... using standard techniques that are fully compliant with Good Laboratory Practice regulations.12 Plasma albumin concentrations were determined using a bromocresol purple (BCP) assay (QuantiChrom BCP; BioAssay Systems, Hayward, CA).
-
No products found
because this supplier's products are not listed.
Elea Boucard, et al.,
bioRxiv - Bioengineering 2021
Quote:
... FSF and embryonic lung fibroblasts MRC-5 (RD-Biotech, Besançon, France) were expanded in DMEM supplemented with ...
-
No products found
because this supplier's products are not listed.
Mariano A. Ostuni, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 20 glycerol and with 5 Critical Micellar Concentration of CALX173ACE (CALIXAR). CALX173ACE solubilized CX3CL1 was loaded into magnetic beads previously crosslinked to polyclonal anti-CX3CL1 antibody using an IP kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...
-
No products found
because this supplier's products are not listed.
Alessandro Gori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The detector antibody (biotinylated CD9, CD63, CD81 antibodies by Ancell or anti-band 3 from Santa Cruz) solutions (0.3 µg/ml ...
-
No products found
because this supplier's products are not listed.
Lucy I. Crouch, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Control samples were digested with PNGase F (1 μl, 5 mU, QA-Bio) For Pngase-003341 the final enzyme concentration was 1 μM ...
-
No products found
because this supplier's products are not listed.
Yalda Afshar, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Confluent endothelial monolayers were grown on tissue culture treated 6-well plates (Falcon #08-772-1B) in complete MCDB-131 media (VEC Technologies # MCDB131-WOFBS) plus 10% FBS (Omega Scientific #FB-11 ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Gary Reynolds, et al.,
bioRxiv - Immunology 2020
Quote:
... then resuspended in 200 μl of flow buffer per 106 cells with 3 μM DAPI (Sysmex Partec, 05-5005). Cells were then run through a Fortessa X20 for analysis ...
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
William Finnigan, et al.,
bioRxiv - Bioengineering 2020
Quote:
N-R7-C at 300 mg/mL was extruded using a syringe pump through a pre-pulled glass capillary (MGM-3-1.5-5NF, 30 μm tip, FivePhoton Biochemicals) at 0.5 mL/h using a syringe pump (Cole-Palmer 74900 series ...
-
No products found
because this supplier's products are not listed.
Maia Moog, Scott C. Baraban,
bioRxiv - Neuroscience 2022
Quote:
... were amplified at a gain of 20x and filtered at 1 kHz (−3 dB; eight-pole Bessel; Cygnus Technology, Inc.), digitized at 10 kHz using a Digidata 1320 A/D interface (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Kevin G. Burt, et al.,
bioRxiv - Bioengineering 2023
Quote:
... IVDs were cultured in DMEM/F12 with 5% Fetal Bovine Serum (FBS, Crystalgen, Cat #FBS-500HI) and 1 % Penicillin-Streptomycin ...
-
No products found
because this supplier's products are not listed.
Aleksei Kuznetsov, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and SARS-CoV-2 Spike protein S1 (Icosagen OÜ, Estonia, cat# P-305-100) were used in this study.
-
No products found
because this supplier's products are not listed.
Romain Lanotte, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Cells were then transiently transfected with 5 μg of each construct using Metafectene (Biontex Lab.; München, Germany), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Mustafa G. Aydogan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2) The mCherry tag was replaced with either mNeonGreen (Shaner et al., 2013) (Allele Biotechnology) or mKate2 (Shcherbo et al. ...
-
No products found
because this supplier's products are not listed.
Ortal Iancu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... using combinations of 4 primers for Vγ and 3 primers for Jγ regions in each reaction (IdentiClone™ TCRG Gene Clonality Assay, Invivoscribe, Inc.). TRG clonality was ran and analyzed on 2% agarose gel ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Alyssa R. Phillips, et al.,
bioRxiv - Plant Biology 2023
Quote:
... About 1 mm of the tip (meristem and root cap) was excised and transferred to a tube containing 20 µL of 3% cellulase R-10 (Desert Biologicals, Phoenix, AZ) and 1.25% pectolyase Y-23 (Desert Biologicals ...
-
No products found
because this supplier's products are not listed.
Sudeshna Saha, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5% CO2 and shaking at 200 rpm in presence or absence of 30 µM CMP-Neu5Ac (Nacalai USA. Inc.) until OD600 equivalent to 0.4– 0.5.
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
William J Dower, et al.,
bioRxiv - Immunology 2023
Quote:
... for 5-10 min at 25°C and the reaction was stopped using STOP solution (Surmodics Cat# LSTP-1000-01).
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Serial cross sections (5□µm thick) were immunostained with rabbit anti-mouse LYVE1 (1:100) polyclonal antibody (11-034, AngioBio Co). DAB (3,3′ -Diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Laura Martinez-Ruiz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Tumor pieces were digested using 5–10 mL of a 2.5 mg/mL Collagenase NB4 standard (S1745401 Nordmark Biochemicals, Uetersen, Germany) solution in PBS + 3 mM CaCl2 for 2 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Elizabeth C. Townsend, et al.,
bioRxiv - Microbiology 2023
Quote:
... the samples were stained with a PNA-FISH-TexasRed-5-conjugated universal bacterial (BacUni) 16s rRNA probe (AdvanDx, Woburn, MA, US), incubated and then counterstained with 3 µM 4′,6-diamidino-2-phenylindole (DAPI ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... whole blood (10 µL) was mixed with 2 mM EDTA (10 µL) and analyzed using the HemaVet 950S (Drew Scientific).
-
No products found
because this supplier's products are not listed.
Angus M Sidore, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... The individual wells were then washed >5 times using 2X Bind & Wash Buffer and a 384-Well Post Magnetic Plate (Permagen Labware, Peabody, MA). After washing ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Jordina Rincon-Torroella, et al.,
bioRxiv - Cancer Biology 2023
Quote:
MIA PaCa-2 or Panc 02.13 cells were transduced with a CMV-Firefly luciferase lentivirus carrying a puromycin-selectable marker (Cellomics Tech; Halethorpe, MD, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Yu-Heng Tseng, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were saturated with 5% milk powder in PBS with 0,05% Tween-20 (PBS-T) followed by immunostaining with anti-GFP antibodies (Torrey Pines Biolabs, 1:5000 in PBS-T) and secondary goat-anti-rabbit antibodies coupled to alkaline phosphatase (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...