-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Christina Strauch, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and nuclei were visualized using 4’,6-diamidino-2-phenylindole (DAPI) in mounting medium (SCR-038448; Dianova, Hamburg, Germany).
-
No products found
because this supplier's products are not listed.
Beibei Wu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Isolates were cultured on Middlebrook medium for 4-6 weeks at 37°C and DNA was extracted using magnetic beads (Tiangen Biotech Co., Ltd.). Rifampicin and isoniazid drug-susceptibility testing was performed using the proportion method in Löwenstein-Jensen medium (Aziz et al ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus wood particles were decomposed with a mixture (20 mL) of acetic acid containing 1% peracetic acid using a microwave reactor (Biotage Initiator Plus) at 50 ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnology, Cat.#21141). Gel imaging was conducted on a Gel Doc XR+ System (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 12-port valves (IDEX, EZ1213-820-4) and a peristaltic pump (Gilson ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Uwe Schwartz, et al.,
bioRxiv - Microbiology 2023
Quote:
... 4 hpi using TRI Reagent (Molecular Research Center, Inc.). Two time series sets of total RNA were prepared from two independent infections ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
No products found
because this supplier's products are not listed.
Matthew Prideaux, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Antibody against fatty acid binding protein 4 (FABP4) was purchased from ProSci, Inc ...
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Amirala Bakhshian Nik, et al.,
bioRxiv - Pathology 2022
Quote:
... Osteoblasts (passage 4-6) were harvested using 0.25% trypsin-EDTA solution (Caisson Labs, TRL01), seeded with a density of 5,200 cell.cm-2 ...
-
No products found
because this supplier's products are not listed.
Yusong Guo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The BC-1471 compounds (TargetMol, CAS 896683-84-4 and CAS 896683-78-6) were also evaluated with STAMBPJAMM under identical conditions with a final concentration of 1 μM ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
No products found
because this supplier's products are not listed.
Grace I. Borlee, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 100 nM of 2-chloro-adenosine-5’-O-monophsphate (2-Cl-5’-AMP, Axxora, LLC) for internal standardization ...
-
No products found
because this supplier's products are not listed.
Sandeep Surendra Panikar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The purified mAbs was then reacted with a 20-fold molar excess of 2-S-(4-Isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid (p-SCN-Bn-NOTA, Macrocyclics) overnight at 4 °C with gentle agitation ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Rasmus Ree, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Couplings were performed using 3-6 equivalents Fmoc-amino acid/TBTU and 6-12 equivalents N-methylmorpholine on the following resin: Tentagel S Trityl resin (RAPP Polymere, Germany), loading ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Unsorted Lin− cells or sorted HSCs were cultured in a retronectin-coated 6 cm2 dish with 3 mL viral supernatants for 6 h in 3 mL IMDM media supplemented with 15% heat inactivated fetal bovine serum (Atlanta Biologicals), 1% bovine serum albumin (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Yilin Yang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cdh5-CreERT2 mice (3 Kate2 vs. 4 HDAC6) were fed with a control liquid diet (F1259SP, Bio-Serv) for 10 days and were sacrificed for sample collection ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
Glucose-6-Phosphate Dehydrogenase Kit
Cat# DGPDH-100,
1.0 kit, 100 tests, USD $339.0
Ask
Kaori Kobayashi, et al.,
bioRxiv - Immunology 2021
Quote:
The concentrations of total sialic acid (TSA) and free sialic acid (FSA) in saliva were measured using a sialic acid assay kit (Bioassay Systems). The concentration of protein-bound sialic acid (BSA ...
-
No products found
because this supplier's products are not listed.
Janani Ramachandran, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Differential SMARCC1 binding between E11.5 (40-43s) control (Gli3+/+; n=3) and Gli3-/- (n=4) samples was conducted using an E.coli spike-in (EpiCypher 18-1401) of 0.125ng/sample ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Mary V. Arrastia, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... the nuclei concentration was assessed by loading 6 µL of the solution into a disposable hemocytometer (4-Chip Disposable Hemocytometer, Bulldog Bio, #DHC-N420, Portsmouth, NH). After determining nuclei concentration ...
-
No products found
because this supplier's products are not listed.
Megan R. Sayyad, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and non-essential amino acids (0.02mM, Gemini Bio-Products). The mouse mammary carcinoma cell line 4T1 (gift from Dr ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
C Spourquet, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and Dox 4 days (Day 4) thyroid (n=4; 2 males and 2 females for each group) were sequenced by GENEWIZ-NGS Europe (Germany ...
-
No products found
because this supplier's products are not listed.
Wisath Sae-Lee, et al.,
bioRxiv - Systems Biology 2021
Quote:
... For ghosts dissolved in Diisobutylene/Maleic Acid (DIBMA, Cube Biotech) (Oluwole et al. ...
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (4) Spin-coating LOR3A photoresist (MicroChem) at 4000 rpm ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Ruhul Amin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 6-well plates with elastic moduli of 0.2 kPa (considered soft) was purchased from Matrigen. Regular 6-well tissue culture dishes were used to represent stiff matrices (elastic moduli is >GPa) ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
... Nanogold particles were developed for 3 min using GoldEnhance™ (Nanoprobes). Gold enhancement was followed by fixation with 1.6% glutaraldehyde and 0.2% tannic acid in PBS ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...