-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Timo Baade, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6 (mouse monoclonal, D14HD11, Aldevron; WB 1:6000, IF 1:200); mouse monoclonal anti 6xHis (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
magnetofection
difficult to transfect cells
Cat# KC30296,
PolyMag 100µL+PolyMag Neo100µL+ CombiMag 100µL+Magnetic Plate MF96000, USD $640.63/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Kazuya Ishikawa, et al.,
bioRxiv - Microbiology 2022
Quote:
... The membrane was treated with 1:1000 anti- lipoteichoic acid antibody (clone 55, Hycult Biotech, Uden, The Netherlands) and washed 3 times with phosphate buffered saline ...
-
No products found
because this supplier's products are not listed.
Susanne Hellmuth, Olaf Stemmann,
bioRxiv - Cell Biology 2024
Quote:
... raised against CAKSKAKPPKGAHVEV = Cys + amino acids 1183-1197 of the human protein) and human anti-CREST (1:1,000; hct-0100, ImmunoVision). Secondary antibodies (all 1:500) ...
-
No products found
because this supplier's products are not listed.
Samantha Mar, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... The spheroids were transferred into 500 μL acid ethanol (1 M HCl in 70% ethanol) for either human C-peptide ELISA (Alpco) or human glucagon ELISA (Mercodia).
-
No products found
because this supplier's products are not listed.
Aditya S. Paul, et al.,
bioRxiv - Microbiology 2020
Quote:
... a synthetic fragment for a recodonized 3’ sequence of exon 1 followed by the artificial loxPint (IDT DNA), and a PCR-amplified fragment of the 5’ end of pfpp1 exon 2 (601 bp) ...
-
No products found
because this supplier's products are not listed.
Yan Liu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... adult mice were immunized by intradermal injection of 100 µg of bovine type II collagen that was emulsified in 100 µl of emulsion containing 50 µl acetic acid (0.01 M) and 50 µl CFA (1 mg/ml Myobacterium tuberculosis; Chondrex Inc, Woodinville, WA) at the base of the tail ...
-
No products found
because this supplier's products are not listed.
Akila Wijerathna-Yapa, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The samples were acidified to 1% (v/v) with formic acid and solid-phase extraction cleaned using Silica C18 Macrospin columns (The Nest Group). After each of the following steps ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Bao Gia Vu, W. Scott Moye-Rowley,
bioRxiv - Genetics 2021
Quote:
... or under amino acid-selective conditions in complete supplemental medium (CSM) (Difco yeast nitrogen extract without amino acids, amino acid powder from Sunrise Science Products, 2% μg/ml nourseothricin (Jena Bioscience ...
-
Cat# H6A313-1,
USD $335.0/ml
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-UL44 mAb (Virusys Corporation, #P1202-1; 1:100); α-pp65 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Carine Rey, et al.,
bioRxiv - Genomics 2022
Quote:
... belari bub-1 (gene mbelari.g12204) (1/10000 Covalab). Two peptides C-ALNASKEKPEEQLD-coNH2 and C-SPIVEDQDHENSTNG-coNH2 were injected in rabbits and the purified serum obtained at day 74 was used for staining.
-
No products found
because this supplier's products are not listed.
Hafsa Munir, et al.,
bioRxiv - Cancer Biology 2020
Quote:
1×105 neutrophils were treated with CAF CMed diluted 1:1 in complete EC media (Cell Biologics) with or without Cl-amidine and incubated for 3h to generate NETs ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Antwi-Boasiako Oteng, et al.,
bioRxiv - Physiology 2021
Quote:
... non-esterified fatty acids (Wako Diagnostics), and cholesterol (Cholesterol E ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... stearic acid (NU-CHEK PREP, INC) were conjugated with fatty acid free BSA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Tamjid A Chowdhury, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Naphthaleneacetic acid (K-NAA) (Phytotechnology Laboratories) was dissolved in double distilled water to obtain 250 mM K-NAA solution and filter-sterilized by passing through 25 mm sterile syringe filter (Pall Corporation) ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Kento T. Abe, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were washed three times with 200 μl PBS-T and blocked for 1-1.5 hr at room temperature with 200 μl 3% BSA (BioShop Canada Inc. #SKI400.1, lot #9H61850). After washing as above ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Salla Kyheröinen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Phospho-Ser3 cofilin antibody (11139-1, 1:1000) was from Signalway antibody. The following secondary antibodies were from Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Nicholas N. Foster, et al.,
bioRxiv - Neuroscience 2020
Quote:
... fluorogold (FG, 1%; Fluorochrome); and cholera toxin subunit B-AlexaFluor 647 conjugate (CTB ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
No products found
because this supplier's products are not listed.
Bart C.J. Dirven, et al.,
bioRxiv - Neuroscience 2024
Quote:
... incubation of the primary antibodies was performed overnight (guinea pig anti-cFos, 1:750, 226004, Synaptic Systems; rat anti-RFP, 1:1000, 5f8, Chromotek; mouse anti-5mC, 1:500, GWB-BD5190, GenWay Biotech ...
-
No products found
because this supplier's products are not listed.
Haylie R. Helms, et al.,
bioRxiv - Bioengineering 2024
Quote:
GFP+ HUVEC and RFP+ MDA-MB-231 were printed onto a collagen type 1 substrate and in cultured in a 1:1 ratio of HUVEC media (VascuLife VEGF, Lifeline Cell Technology) and MDA-MB-231 media (DMEM + 10% FBS + 1% penicillin-streptomycin) ...
-
No products found
because this supplier's products are not listed.
Sangeeta Ghuwalewala, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Mice were fed with doxy chow (1 g doxy/1 kg, Bio-serv) for the indicated chase periods ...
-
No products found
because this supplier's products are not listed.
Takumi Kitamoto, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... GLP-1 concentrations were determined by mouse GLP-1 ELISA Kit (Crystal Chem). mGOs were lysed in CelLytic™ M (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Johannes Yayo, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Waters amino acid standard solution with 17 amino acids (cat. no. WAT088122) was mixed with glutamine (Irvine Scientific, Tilburg, The Netherlands), asparagine ...
-
No products found
because this supplier's products are not listed.
Hammam Antar, Stephan Gruber,
bioRxiv - Microbiology 2023
Quote:
... Equal volumes of each solution were mixed together (protein:ligand 1:1) using BenchSmart 96 (Rainin) dispenser robot and mixed through pipetting ...
-
No products found
because this supplier's products are not listed.
Jaganathan Subramani, et al.,
bioRxiv - Microbiology 2021
Quote:
... P.1 (Gamma; Cube Biotech #28723), and B.1.617.2 (Delta ...
-
No products found
because this supplier's products are not listed.
Koji Kato, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and JAFIS Tool version 1 (JEOL). All image stacks were collected from 5 × 5 holes per stage adjustment to the central hole and image shifts were applied to the surrounding holes while maintaining an axial coma-free condition ...
-
No products found
because this supplier's products are not listed.
Megan Mey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TrkB ser478 (1:1,000; Biosensis, CA), LHCGR (1:500 ...
-
No products found
because this supplier's products are not listed.
Clinton Cheney, et al.,
bioRxiv - Microbiology 2024
Quote:
... with RedSafe Nucleic Acid Staining Solution (Bulldog Bio, Portsmouth, NH) and electrophoresis settings of 85 V for 45 minutes.
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thomas Keating, et al.,
bioRxiv - Immunology 2021
Quote:
... 1:500 mouse anti-human C1q (Quidel) or 1:100 mouse anti-human Ficolin-3 (Hycult ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Joanna J. Moss, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and anti-mouse (G32-62G, 1:10,000, SignalChem) horseradish peroxidase-conjugated antibodies at room temperature for 1 hr before exposure on photographic film (28906844 ...
-
No products found
because this supplier's products are not listed.
Francesco Pesce, et al.,
bioRxiv - Biophysics 2022
Quote:
... 1 mM DTT) and cells lysed by 1 cycle of French Press at 25 kPsi (Constant Systems Ltd MC Cell Disrupter). The lysate was centrifuged at 4 °C and 20000 g for 30 min and the supernatant applied to a gravity flow column with 4 mL pre-equilibrated Ni-NTA Sepharose resin (GE Healthcare) ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhao, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... pLKO.1-shEFNA4 was synthesized by GENEWIZ (Suzhou, China). And pLKO.1-shNC expressing luciferase was used as control ...