-
No products found
because this supplier's products are not listed.
AL Seufert, et al.,
bioRxiv - Immunology 2022
Quote:
... 2% endotoxin- and fatty acid-free bovine serum albumin (BSA; Proliant Biologicals) and 10% M-CSF ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Dewi Safitri, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... HEK293T cells overexpressing full-length GIPR or GLP-1R with an N-terminal FLAG tag were purchased from Multispan, Inc (Hayward ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Charlène Iltis, et al.,
bioRxiv - Immunology 2021
Quote:
... membranes were stripped at 4°C in agitation using Antibody stripping buffer 1X for 10 minutes (Gene Bio-Application). Protein bands were quantified using ImageJ software ...
-
No products found
because this supplier's products are not listed.
Ortal Iancu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... using combinations of 4 primers for Vγ and 3 primers for Jγ regions in each reaction (IdentiClone™ TCRG Gene Clonality Assay, Invivoscribe, Inc.). TRG clonality was ran and analyzed on 2% agarose gel ...
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...
-
No products found
because this supplier's products are not listed.
Dorothee Jakob, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... we applied the spider toxin peptide Grammostola spatulata mechanotoxin 4 (GsMTx4) L-isomer (10 μmol/L, H20 as solvent, CSBio, Menlo Park, CA, USA), a known blocker of cation non-selective SAC ...
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
Lucia Sedlackova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM NR (ChromaDex), 10 μM olaparib (Cambridge Biosciences) ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interleukin 6 (IL6) ELISA Kit (RD-IL6-Mu, Reddot biotech), Mouse Interferon Gamma Induced Protein 10kDa (IP10 ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Elea Boucard, et al.,
bioRxiv - Bioengineering 2021
Quote:
... FSF and embryonic lung fibroblasts MRC-5 (RD-Biotech, Besançon, France) were expanded in DMEM supplemented with ...
-
No products found
because this supplier's products are not listed.
Mariano A. Ostuni, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 20 glycerol and with 5 Critical Micellar Concentration of CALX173ACE (CALIXAR). CALX173ACE solubilized CX3CL1 was loaded into magnetic beads previously crosslinked to polyclonal anti-CX3CL1 antibody using an IP kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Yalda Afshar, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Confluent endothelial monolayers were grown on tissue culture treated 6-well plates (Falcon #08-772-1B) in complete MCDB-131 media (VEC Technologies # MCDB131-WOFBS) plus 10% FBS (Omega Scientific #FB-11 ...
-
No products found
because this supplier's products are not listed.
Colin Kremitzki, et al.,
bioRxiv - Genetics 2023
Quote:
Lentiviruses carrying the gRNA libraries were packaged into 8×106 HEK 293T cells/well in a 6-well plate (TPP92006, MIDSCI, Fenton, MO, USA), using the TransIT Lentivirus transfection reagent (MIR 6600 ...
-
No products found
because this supplier's products are not listed.
Erika Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 5 μL of each dilution was plated on CHROMagar™ O157 plates (Drg International Inc). The plates were incubated at 30 °C for 24 h ...
-
No products found
because this supplier's products are not listed.
Romain Lanotte, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Cells were then transiently transfected with 5 μg of each construct using Metafectene (Biontex Lab.; München, Germany), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Angelo D’Alessandro, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Lysed RBCs were then mixed 1:1 with Hemoglobind (Biotech Support Group), followed by end over end rotation for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
William J Dower, et al.,
bioRxiv - Immunology 2023
Quote:
... for 5-10 min at 25°C and the reaction was stopped using STOP solution (Surmodics Cat# LSTP-1000-01).
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Angus M Sidore, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... The individual wells were then washed >5 times using 2X Bind & Wash Buffer and a 384-Well Post Magnetic Plate (Permagen Labware, Peabody, MA). After washing ...
-
No products found
because this supplier's products are not listed.
Franz Meitinger, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... AZD1390 (ATMi; 1 μM; Chemgood LLC); Palbociclib (CDK4/6i ...
-
No products found
because this supplier's products are not listed.
Sylvain Perriot, et al.,
bioRxiv - Immunology 2024
Quote:
... -C (1:500, AffinityImmuno, clone W6/32) were incubated in 250ul blocking buffer with neurons overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Ellen Gingrich, Kendra Case, A. Denise R. Garcia,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-BrdU (1:500, Maine Biotechnology Services), mouse anti-CC1 (1:1k ...
-
No products found
because this supplier's products are not listed.
Chuan Liu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... diluted 1:60 or porcine kidney ECM (Xylyx Bio ...
-
No products found
because this supplier's products are not listed.
Yann-Ru Lou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1:1 v/v) and loaded to the silica gel column (100 g, 200-425 mesh, 60 A, Jade Scientific Inc, Westland, MI, USA) packed with ethyl acetate/hexane (200 mL ...
-
No products found
because this supplier's products are not listed.
Sung Hee Ko, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analyzed by electrophoresis with precast 1% agarose gel (Embi Tec) or the Agilent High Sensitivity DNA kit (5067-4626 ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... applying polyclonal anti-human epidermal transglutaminase (TG3) antibody (Zedira; 1/2000), monoclonal anti-TG4 antibody (Covalab ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...