-
No products found
because this supplier's products are not listed.
Megan Chamberland, Brian Farrell, Johannes Yeh,
bioRxiv - Cell Biology 2022
Quote:
... 2 μm carboxylic acid functionalized silica spheres (Bangs Laboratory) were functionalized with octadecylamine (Sigma ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... (2- (Dimethylamino)-N-(6-oxo-5,6-dihydrophenanthridin-2-yl)acetamide hydrochloride (PJ34; A41159, ApexBio) N-(p-amylcinnamoyl ...
-
No products found
because this supplier's products are not listed.
Tim Marius Wunderlich, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 0.1 M mixture of carboxylic acids (Morpheus screen, Molecular Dimensions). The crystals were harvested into a cryoprotectant solution containing 25% glycerol in mother liquor before cryocooling in liquid nitrogen ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Ruchira Mukherji, et al.,
bioRxiv - Microbiology 2019
Quote:
... as well as a Kinetex Phenyl-hexyl column (50 × 2.1 mm, 1.7 µm, 100 Å, Phenomenex, for phenazine-1-carboxylic acid). Elution gradient ...
-
No products found
because this supplier's products are not listed.
Bella Koltun, et al.,
bioRxiv - Neuroscience 2019
Quote:
... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ...
-
No products found
because this supplier's products are not listed.
Ning Tsao, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
No products found
because this supplier's products are not listed.
Amédée Renand, et al.,
bioRxiv - Immunology 2020
Quote:
... sequences [SLA (p1-p53)] or 0.6 nmol/mL PepTivatorR Candida albicans MP65 (peptides pools of 15 amino acids length with 11 amino acid overlap, Miltenyi Biotec) in 5% human serum RPMI medium in the presence of 1µg/ml anti-CD40 (HB14 ...
-
No products found
because this supplier's products are not listed.
Soma Szentkirályi-Tóth, et al.,
bioRxiv - Neuroscience 2023
Quote:
... biotin-conjugated anti-mouse IgG (Jackson ImmunoResearch Laboratories; 1:500; 2h; RT), ABC Elite reagent (Vector ...
-
No products found
because this supplier's products are not listed.
Robert C. Klipp, John R. Bankston,
bioRxiv - Biophysics 2022
Quote:
... pulled to a resistance of 2–6 MΩ (P-1000; Sutter Instrument) and filled with an internal solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Marie-Lynn Al-Hawat, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Sulfo-cyanine 7 carboxylic acid was obtained from Lumiprobe (Cockeysville, MD). IRDye 680RD NHS Ester was obtained from LI-COR Biosciences (Lincoln ...
-
No products found
because this supplier's products are not listed.
Yihe Huang, Wei Lü, Juan Du,
bioRxiv - Biophysics 2023
Quote:
... For nanodisc samples, 0.5 mM (1H, 1H, 2H, 2H-Perfluorooctyl)-β-D- Maltopyranoside (FOM, Anatrace) was added for improving particles distribution and contrast ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Lydia C. Cameron, et al.,
bioRxiv - Microbiology 2019
Quote:
... cis-2-decenoic acid (F13807D, Carbosynth) was also added at a concentration of 310nM (35).
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Jennifer Hua, et al.,
bioRxiv - Neuroscience 2022
Quote:
... BML-P137) for 1h and 2h before reading fluorescence (ex 365, em 440) on a plate reader (Flexstation 3, Molecular Devices,). For cathepsin B activity assessment by microscopy ...
-
No products found
because this supplier's products are not listed.
Xinyu Xie, et al.,
bioRxiv - Immunology 2024
Quote:
... 6-diamidino-2-phenylindole ( DAPI) (Solarbio, C006, China) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Ricardo Guerrero-Ferreira, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and lyophilized for 2h in an Eppendorf concentrator (Eppendorf) and stored at −80°C until use.
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
James A. D’Amour, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Electrodes of 4-6 MOhm resistance (borosilicate glass, World Precision Instruments, no. TW150F-3) were prepared on Narishige (PP-830 ...
-
No products found
because this supplier's products are not listed.
Esmeralda Vásquez Pacheco, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 × 105 cells were seeded per well in 6-well plates (Greiner Bio-One). The following day ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
Prepared to contain high collagenase activity with a caseinase to collagenase ratio of ~2:1....
Cat# LS005318,
100 mg, $60.00
Ask
Nathan C. Winn, et al.,
bioRxiv - Physiology 2022
Quote:
... and digested in 6 ml of 2-mg/mL type II collagenase (Worthington # LS004177) for 30 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Jae Won Lee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 3-oxo-DCA were purchased from Steraloids (Newport, RI, USA). Isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Anjali H. Kurup, et al.,
bioRxiv - Microbiology 2021
Quote:
... The XTT ([2,3-bis-(2methoxy-4-nitro-5-sulfophenyl)- 2H-tetrazolium-5carboxanilide) assay was purchased from Dojindo Molecular Technologies (Rockville ...
-
No products found
because this supplier's products are not listed.
Huiwang Zhan, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 400mM 3-Bromopyruvic acid (BioVision, #B1045), 20 mM MitoTracker (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
David Forgacs, et al.,
bioRxiv - Immunology 2021
Quote:
... Plates were then washed 5 times with PBS/0.05% Tween20 prior to development with 100μL of 0.1% 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS, Bioworld, Dublin, OH, USA) solution with 0.05% H2O2 for 18 minutes at 37°C ...
-
No products found
because this supplier's products are not listed.
Subash Godar, et al.,
bioRxiv - Biophysics 2021
Quote:
... We detected the bound alkaline phosphatase labeled antibodies by incubating the membrane in BCIP/NBT (5-bromo, 4-chloro, 3- indolylphosphate/nitro-blue tetrazolium, AMRESCO, LLC.) substrate for 30–45 minutes ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Dhiraj Kumar Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... or anti-SARS CoV-2 nucleocapsid (N) antibody (Sino Biologicals, USA, 1:100, 2h at 37°C). Antihuman ACE-2 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Kacey Mersch, et al.,
bioRxiv - Biophysics 2020
Quote:
... 20 mM 3-(N-morpholino)propanesulfonic acid (MOPS, RPI), 5 mM DM ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
Amy Krans, et al.,
bioRxiv - Neuroscience 2019
Quote:
... ubiquilin 2 (Novus Biologicals, 1:200, acid AR), NTF1 (Abclonal ...
-
No products found
because this supplier's products are not listed.
Chhiring Lama, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 6-diamidino-2-phenylindole (Spectral DAPI, Akoya Biosciences) was applied per provided protocols to label nuclei ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Brendan Rooney, et al.,
bioRxiv - Cell Biology 2021
Quote:
... we incubated membranes with 1X NewBlot Nitro Stripping Buffer (LI-COR, cat. no. 928-40030) for 5 minutes at RT on a shaker before re-blocking and probing as above ...
-
No products found
because this supplier's products are not listed.
Carmen Mirabelli, et al.,
bioRxiv - Microbiology 2022
Quote:
... the 2h condition was harvested in TRI Reagent (Zymo Research, R2050-1) and the rest of infected-HIE were resuspended in BME and plated in a pre-warmed 24-well plate (3x 10uL drop/condition) ...
-
No products found
because this supplier's products are not listed.
David G. Saliba, et al.,
bioRxiv - Immunology 2019
Quote:
SUV mixtures were injected into flow chambers formed by sealing acid piranha cleaned glass coverslips to adhesive backed plastic manifolds with 6 flow channels (StickySlide VI 0.4; Ibidi) (16) ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Natascha Andrea Kuenzel, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Image acquisition for Figure 2H was done with a Zeiss Axiovert 200 fluorescence microscope (Carl Zeiss) using a 63x objective with a charge-coupled-device (CCD ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Samantha Sarni, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
2-Oxo-3-phenylpropanoic acid (Phenylpyruvic acid) is used in the synthesis of 3-phenyllactic...
Cat# S6131, SKU# S6131-25mg,
25mg, $97.00
Ask
Cecilia Roux, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 2 uM retinoic acid (Selleck Chemicals), 0.66 uM JQ1 (Selleck Chemicals) ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...