-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
Carbohydrate
Cat# GMS0173S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... version 6 (DNAStar). Consensus sequences were derived from at least two independent forward and reverse sequences ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Jessica Hoff, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 U mL-1 DY-636 conjugated Phalloidin (Dyomics) for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... (6) was purchased from GenTarget Inc.
-
No products found
because this supplier's products are not listed.
Marissa L. Maciej-Hulme, et al.,
bioRxiv - Biochemistry 2020
Quote:
1 µl BODIPY-FL hydrazide (5 mg/mL, Setareh Biotech, Eugene, OR, USA) in DMSO was diluted in HPLC grade water before addition of organic solvent in a 1:9 (v/v ...
-
No products found
because this supplier's products are not listed.
Emily S. Bellis, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Czech Republic; CAS: 151716-18-6) or (±)orobanchol (Olchemim; CAS: 220493-64-1) at 0.01 µM and (±)-GR24 (Chempep, Wellington ...
-
No products found
because this supplier's products are not listed.
Michael G. LaMontagne, et al.,
bioRxiv - Microbiology 2022
Quote:
... Temperature and dissolved oxygen were measured in situ at 3 – 5 cm beneath the surface with a YSI model 55 dissolved oxygen (DO) probe (YSI Inc., Young Spring, OH). Water samples were split in the field for FIB (E ...
-
WB, ELISA
Cat# CDC-53,
0.05 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Frank M. Mason, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... telomere (PNA, TelC-A647, 1:500), Acro-P (Cytocell, LPE NOR, undiluted) or rDNA (Empire Genomics, RPCI23-225M6, 1:5) FISH probes were diluted in hybridization solution (10mM Tris-HCl pH7.2 ...
-
No products found
because this supplier's products are not listed.
George R. Nahass, et al.,
bioRxiv - Biochemistry 2020
Quote:
... We preloaded plates with 6 glass or silica beads (1 mm in diameter, BioSpec Products or 0.8 mm, OPS Diagnostics, respectively) per well ...
-
No products found
because this supplier's products are not listed.
Douglas S. Reed, et al.,
bioRxiv - Microbiology 2023
Quote:
... −6 to −15 psi (AGI; Ace Glass, Vineland, NJ). Particle size was measured once during each exposure at 5 minutes using an Aerodynamic Particle Sizer with a diluter at 1:100 (TSI ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Alex M. Eddie, et al.,
bioRxiv - Immunology 2021
Quote:
... in a 6-well cell culture plate (Peak Serum Inc. Cat. #TR5000), supplemented with recombinant mouse BAFF (10 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Paule Dagenais, et al.,
bioRxiv - Biophysics 2021
Quote:
... excisions of rays were conducted using a micro dissecting knife (RS-6220, dean knife 5” 1 mm x 7 mm blade curved, Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Frøydis Sved Skottvoll, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-MAM-d6 and morphine-d3 were purchased from Cerilliant (Austin, TX, USA). Unless otherwise stated ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Mason J. Appel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Colonies were picked manually (sublibraries 1 and 5 only) or using a PIXL robotic colony picker (Singer Instrument Company, Somerset, UK) at the Stanford University School of Medicine Genome Technology Center (Palo Alto ...
-
No products found
because this supplier's products are not listed.
Kathleen N. Brown, et al.,
bioRxiv - Pathology 2023
Quote:
... and the cells were resuspended in ~500 μL 1% FBS in PBS and transferred to polystyrene 5 ml flow cytometry tubes (MTC Bio). The samples were placed on ice and protected from light until flow cytometry could be performed ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Brandon T. Cisneros, Neal K. Devaraj,
bioRxiv - Synthetic Biology 2020
Quote:
... 3-Methylxanthine was purchased from AK Scientific (Union City, CA). Xanthine was purchased from Chem Impex International (Wood Dale ...
-
No products found
because this supplier's products are not listed.
Orsolya Németh-Szatmári, et al.,
bioRxiv - Molecular Biology 2022
Quote:
6 × 105 cells/flask were seeded into T25 cell culture flasks (Biologix, Jinan, Shandong, China) and left to grow for 24 h ...
-
No products found
because this supplier's products are not listed.
Kellie A. Cotter, et al.,
bioRxiv - Genomics 2022
Quote:
... to reduce uncapped RNAs to 5′ hydroxyls and make them incapable of ligating to 5′ adaptor and Cap-Clip (catalog no. C-CC15011H; Cambio) to remove the 5′ cap of transcripts that had undergone guanylation and allow them to be incorporated into the library through 5′ adapter ligation ...
-
No products found
because this supplier's products are not listed.
Jia Gu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The cells were exposed to 6 Gy radiation from the X-ray tube (Rad Source Technologies, USA) at a fixed dose rate of 1.15 Gy/min.
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... for 3 hours at room temperature in a peptide synthesis vessel (ChemGlass, Vineland, NJ). The peptide solution was filtered to remove the resin and the peptide was precipitated out using diethyl ether at -80°C ...
-
No products found
because this supplier's products are not listed.
Andrew T. Phillips, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or β5-integrin (Assay Biotechnology; San Franscisco, CA; catalogue #: F-5) primary antibody for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Yara Eid Mutlak, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Phospho-Serine antibody was from ECM biosciences (Cat# PP2551, lot# 5). Anti-Laminin (Cat# L9393 ...
-
No products found
because this supplier's products are not listed.
Adam T. Hilterbrand, et al.,
bioRxiv - Microbiology 2021
Quote:
... 250 ug/ml G418 and 5 ug/ml of puromycin (AG Scientific). CHO-nectin-1 cells were a gift from Richard Longnecker (Northwestern University) ...
-
No products found
because this supplier's products are not listed.
Maciej M. Jankowski, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the outer panels of every third section contain two nose-poke ports (Fig 2; a total of 12 ports in 6 sections, SPECIAL.090-SE v1.0, LaFayette-Campden Instruments, Loughborough, UK). One of the two ports in each section is connected to a liquid pump and the other to a pellet dispenser ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, et al.,
bioRxiv - Biophysics 2023
Quote:
... Reactions incubated for 5 min at 20 °C before imaging in 96-well chambered coverglass (Brooks Life Science Systems). Samples were imaged using a Nikon A1R Confocal Microscope with a 60x oil immersion lens at the Imaging and Cell Analysis Core Facility at Tufts University School of Medicine ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Immunology 2021
Quote:
... and RNA quality was examined by electrophoresing 1 μg of RNA on a 1% agarose gel containing 1% bleach (Aranda et al., 2012) and 1 × RedSafe nucleic acid staining solution (FroggaBio) in 1 × TAE buffer at 100 V for 35 min ...
-
Cat# IT-52-250,
250 micrograms,USD $2400.0
Ask
Joël S. Bloch, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... the biotinylated samples were desalted into PBS and were mixed at a concentration of 5 μM with a 2.4-fold molar excess of Streptavidin-ZAP (Advanced Targeting Systems, Carlsbad, CA, USA). The mixture was incubated for 1h on ice before diluting it in PBS to a working concentration of 500 nM.
-
No products found
because this supplier's products are not listed.
Celine Everaert, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and 1 µl reaction buffer (ArcticZymes 66001). Of the resulting volume ...
-
No products found
because this supplier's products are not listed.
Maximiliano José Nigro, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit IgG anti-SST (1:1000, BMA Biomedicals), Rabbit IgG anti-VIP (1:1000 ...