-
No products found
because this supplier's products are not listed.
Yan Tang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... the small molecule 3-[2-[(4-Fluorophenyl)methyl]imidazo[2,1-b]thiazol-6-yl]-2H-1-benzopyran-2-one (iMDK; TOCRIS Bio-techne, 9mg/kg), rapamycin (Sirolimus A8167 ...
-
No products found
because this supplier's products are not listed.
Tina H. Dao, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-Methyl-1-phenyl-2- pyrazolin-5-one (Edaravone; Millipore 443300) was resuspended in ethanol at 500mM and heated at 65°C for solubilization ...
-
No products found
because this supplier's products are not listed.
Michelle Y Meng, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) hydrochloride was purchased from Abcam, and RO4 was a gift from Dr Wendy Winchester.
-
No products found
because this supplier's products are not listed.
Vida Kufrin, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cyclopentylidene-[4-(4ʹ-chlorophenyl)thiazol-2-yl]hydrazone (CPTH2) was purchased from ThermoFisher Scientific and used at a 50µM concentration ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Fumiya Kozawa, et al.,
bioRxiv - Cell Biology 2024
Quote:
... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Kentson Lam, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Then 3-(4,5-dimethyl thiazol- 2-yl)-2,5-diphenyl tetrazolium bromide (MTT) labeling reagent (Roche) was added followed by solubilization buffer 2h later ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Neeraja Purandare, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and the remaining compounds (4-Aminobenzanilide, 4-Amino salicylic acid, benzanilide, phenyl benzoate, and phenyl salicylic acid) were from Santa Cruz Biotechnology (Dallas ...
-
No products found
because this supplier's products are not listed.
Michèle Brocard, et al.,
bioRxiv - Microbiology 2021
Quote:
... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
No products found
because this supplier's products are not listed.
Azharul Islam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 4′6-diamidino-2-phenylindole hydrochloride (Vector Laboratories). More than 20 randomly selected fields of view per sample were photographed using a WHN10×/22 eyepiece and a 60× objective (field of view is 1.1 mm ...
-
No products found
because this supplier's products are not listed.
Stefano Suzzi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 4’,6-diamidino-2-phenylindole (1:10,000; Biolegend) was used.
-
No products found
because this supplier's products are not listed.
Anastasia Selyutina, et al.,
bioRxiv - Microbiology 2020
Quote:
... supplemented with 5 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Corning, Corning, NY, USA), 50 μg/ml penicillin/streptomycin (Corning) ...
-
No products found
because this supplier's products are not listed.
Esteban Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
No products found
because this supplier's products are not listed.
Evelien Eenjes, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... DAPI (4’,6-Diamidino-2-Phenylindole) solution (BD Pharmingen, 564907, 1:2000) was added to the secondary antibodies for nuclear staining ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Magdalena A. Sutcliffe, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and the NEBNext Multiplex Oligos from Illumina (Index Primers Set 1, 2, 3 and 4, NEB, E7335S, E7500S, E7710S, E7730S), following the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Florence E. McLean, et al.,
bioRxiv - Microbiology 2024
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
No products found
because this supplier's products are not listed.
Delphine M Depierreux, et al.,
bioRxiv - Microbiology 2021
Quote:
... ULBP-2/5/6 (65903, R&D systems), Plexin-B1 (rea728 ...
-
No products found
because this supplier's products are not listed.
Iqra Nazish, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-4′,6-diamidino-2-phenylindole (DAPI) (Cell Signaling #4083). The primary microglial yield was approximately 5 × 105 cells/flask with minimal astrocyte contamination ...
-
No products found
because this supplier's products are not listed.
Pippa F. Cosper, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
No products found
because this supplier's products are not listed.
Suruchi Sethi, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 2 mM TCEP) and incubated for 1 hour at 4°C before loading on Superose 6 5/150 column (GE Healthcare) equilibrated with the same buffer on an AKTA-micro system (GE Healthcare) ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Eric Franklin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 20% methyl-5-norbornene-2,3-dicarboxylic anhydride and 2% catalyst dimethylbenzylamine (Electron Microscopy Sciences) over four days ...
-
No products found
because this supplier's products are not listed.
Dong Wang, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... stained with spectral 4′,6-diamidino-2-phenylindole (Perkin Elmer), and coverslipped with ProLong Diamond mounting media (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and fibroblast growth factor 2 (FGF-2, 5 ng mL-1; PeproTech). Cells were passaged before reaching 90% confluency and the medium was changed every 2–3 days.
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Yu Xin Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and young (2-4 mo.) wild-type C57BL/6 mice from Jackson Laboratory.
-
No products found
because this supplier's products are not listed.
Sereina O. Sutter, et al.,
bioRxiv - Microbiology 2024
Quote:
... containing 4‘,6-diamidino-2-phenylindole (DAPI) and imaged as midsections by confocal laser scanning microscopy (Leica SP8 ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Dominic D.G. Owens, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Unsorted cells at day 6 (4+2) of differentiation were cultured in MethoCult 04434 (Stem Cell Technologies) in 35 mm dishes ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Eva Dervas, et al.,
bioRxiv - Pathology 2020
Quote:
... followed by a 15 min incubation with DAPI (4′, 6-diamidino-2-phenylindole, Novus Biologicals; 1:10,000 in PBS). Sections were washed twice with distilled water ...
-
No products found
because this supplier's products are not listed.
LN Marziali, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the cells were incubated with 4’,6-diamidino-2-phenylindol (DAPI; 1 μg/ml) and the corresponding Alexa Fluor-conjugated secondary antibodies (1:500; Jackson ImmunoResearch Laboratories) for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Juhi Singh, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM 2-mercaptoethanol and centrifuged with a 70Ti (Beckman coulter) rotor at 40,000 rpm for 18 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 5 ng/ml human FGF-2 (Miltenyi Biotec). Then ...
-
No products found
because this supplier's products are not listed.
Sawsan S Alamri, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with the SARS-CoV-2 S1 subunit (amino acids 1–685) (Sino Biological, China) at 1 μg/ml in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Paulina M. Wojnarowicz, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5 and 6 hours after addition of the reagent using a plate reader (Synergy 2, BioTek).
-
No products found
because this supplier's products are not listed.
Zac Chatterton, et al.,
bioRxiv - Genomics 2022
Quote:
... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
No products found
because this supplier's products are not listed.
Olaf Klingbeil, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... LATS1/2 (GeneTex, GTX87014, 1:1,000), p-LATS1/2 (T1079/T1041 ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Dora Pinto, et al.,
bioRxiv - Immunology 2020
Quote:
... His-tagged RBD of SARS-CoV or SARS-CoV-2 was loaded for 5 minutes at 3 μg/ml in KB onto anti-Penta-HIS (HIS1K) biosensors (Molecular Devices, ForteBio). Association of mAbs was performed in KB at 15 μg/ml.
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...