-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... version 6 (DNAStar). Consensus sequences were derived from at least two independent forward and reverse sequences ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Jack P. K. Bravo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and nanoPOP-6 polymer (Molecular Cloning Laboratories). The oven temperature was set to 65°C ...
-
No products found
because this supplier's products are not listed.
Siran Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 150 pmol of 6×His-streptavidin (ProteoGenix) was mixed with 5 μl of sieved beads (10% ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 6 mm biopsy punched were purchased from McKesson. VECTASHIELD Antifade Mounting Medium (H-1000 ...
-
No products found
because this supplier's products are not listed.
Takushi Shimomura, et al.,
bioRxiv - Biophysics 2022
Quote:
In PI(3, 5)P2-injection experiments, 5 mM PI(3, 5)P2–diC8 (Echelon Biosciences) was manually injected by positive pressure using the glass needle filled with the PI(3 ...
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Junying Zheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... in 6 ml hibernate without calcium (BrainBits, cat. no. HACA) with 15 μl 0.5mM Glutamax ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... (S)-2-amino-6-((2-azidoethoxy)carbonylamino)hexanoic acid (Iris Biotech), (S)-2-amino-6-(((prop-2-yn-1-yloxy)carbonyl)amino)hexanoic acid (AstaTech) ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Nolden, Megan C. Harwig, R. Blake Hill,
bioRxiv - Biochemistry 2023
Quote:
... 0.02% sodium azide) using 6-8 kDa dialysis tubing (Repligen) at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μM Aβ46 (rPeptide) resuspended in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Valeria Taliani, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... resuspended with 5 μg of MATR3 (Supplementary File 5) or IgG antibodies (Immunoreagents Inc.) and incubated for 2 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Kristina Thamm, et al.,
bioRxiv - Cell Biology 2021
Quote:
... On day 6 the cells were detached using CnT-Accutase-100 (CELLnTEC) and counted.
-
Building Block
Sold for research purposes only.
Cat# 1053.0, SKU# 1053-1000 mg,
1000mg, US $2145.00 / EA, EURO, €1950 / EA
Ask
Vittoria Marini, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Mesoderm differentiation (day 0) was induced using 6 μM CHIR99021 (Axon Medchem) for 48 hours in a chemically defined medium consisting of RPMI 1640 (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Craig T. Connors, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 6 weeks-of-age were analyzed by ELISA for insulin (Alpco) and glucagon content (Mercodia) ...
-
No products found
because this supplier's products are not listed.
Cathal Meehan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Recombinant IL-6 with an N-terminal his tag (Fitzgerald, Biosynth Ltd.) was immobilized on His-Pur™ Ni-NTA Resin (ThermoScientific ...
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Oakwood Chemical)/Oxyma (5 eq, Oakwood Chemical) and heated to 90 °C for 2 min while bubbling with nitrogen gas in N,N-dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Konstantin F. Tirronen, Anastasiia S. Kuznetsova,
bioRxiv - Zoology 2023
Quote:
... 5 μL Screen Mix (Evrogen), 1 μL of each primer (10 μM ...
-
No products found
because this supplier's products are not listed.
Silia Ayadi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 6-oxo-cholestan-3β,5α-diol (OCDO; oncosterone) was from Steraloids (Newport, US) and bicalutamide and tamoxifen were from Sigma-Aldrich (Merck KGaA ...
-
No products found
because this supplier's products are not listed.
Jing-Yu Lin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 250 nM 5-Iodotubercidin (Adooq Bioscience), 50 ng/ml FGF10 (PeproTech) ...
-
No products found
because this supplier's products are not listed.
Erika Ganda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5 mL of sterile water and 5 mL of 100% ethanol (Decon Labs, King of Prussia, PA) were added to the tube and the pellet was resuspended by vortexing ...
-
No products found
because this supplier's products are not listed.
Terje Wimberger, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Adaptors to the flow system (NanoPort Std 6-32 Coned 1/32, IDEX, USA) were fixed to in- and outlets ...
-
No products found
because this supplier's products are not listed.
Amirala Bakhshian Nik, et al.,
bioRxiv - Pathology 2022
Quote:
... Osteoblasts (passage 4-6) were harvested using 0.25% trypsin-EDTA solution (Caisson Labs, TRL01), seeded with a density of 5,200 cell.cm-2 ...
-
No products found
because this supplier's products are not listed.
Karen T. Elvers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 μg of BirA (Avidity, LLC), to a final volume of 500 μL buffer [20 mM Tris.HCl pH 7.8 ...
-
No products found
because this supplier's products are not listed.
Charles D Cox, et al.,
bioRxiv - Biophysics 2021
Quote:
... and the cells broken with a TS5/48/AE/6□A cell disrupter (Constant Systems) at 31,000□psi at 4°C ...
-
No products found
because this supplier's products are not listed.
Ruhul Amin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 6-well plates with elastic moduli of 0.2 kPa (considered soft) was purchased from Matrigen. Regular 6-well tissue culture dishes were used to represent stiff matrices (elastic moduli is >GPa) ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Kellie A. Cotter, et al.,
bioRxiv - Genomics 2022
Quote:
... to reduce uncapped RNAs to 5′ hydroxyls and make them incapable of ligating to 5′ adaptor and Cap-Clip (catalog no. C-CC15011H; Cambio) to remove the 5′ cap of transcripts that had undergone guanylation and allow them to be incorporated into the library through 5′ adapter ligation ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Rouhollah Habibey, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SU- 8 5 and SU-8 50 (MicroChem) were subsequently spin-coated on the wafer at different heights (5 µm for microchannels and 100 µm for microwells ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... and 5 µg cholera toxin (List Labs; 100B) in PBS ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Kanishk Jain, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5 μL of GST-tagged reader domain was incubated with 5 μL of 10 nM biotinylated nucleosomes (e.g., EpiCypher #16-9001) for 30 minutes at room temperature in 20 mM HEPES pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Yifei Cai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... human iPSCs maintained in 6-well-plates were harvested by incubating in Accutase (Innovative Cell Technologies AT104) 1 mL/per well plus 10 µM ROCK inhibitor THX (RI)(Tocris #1254 ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
WB, IHC, IF,ELISA
Cat# A5442, SKU# A5442-100ul,
100ul, $157.00
Ask
Ji Geng, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5 mM EDTA) containing protease/phosphatase inhibitor (B14001/B15001, Bimake). After centrifugation at 14,000 × g (4°C ...
-
No products found
because this supplier's products are not listed.
Nour Muinis Ramadan, et al.,
bioRxiv - Immunology 2020
Quote:
... supplemented with 5% of sheep blood (LAMPIRE biological laboratories, PA) and incubated anaerobically with CO2 anaerobic pack (AnaeroPack® System ...
-
No products found
because this supplier's products are not listed.
D. Lapaillerie, et al.,
bioRxiv - Microbiology 2020
Quote:
... The 5’-biotinylated 601 sequence was purchased from TEBU-Bio. Biotinylated histone tail peptides were purchased from Eurogentech (Angers ...
-
No products found
because this supplier's products are not listed.
Catarina J. Gaspar, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were transfected with fluorescent reporter constructs (1 μg total DNA/well, 6 well plate) using GenJet (SignaGen Laboratories) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jian Hang Lam, et al.,
bioRxiv - Immunology 2022
Quote:
... The plate was left to incubate for 6 hours followed by addition of the ESF-AF medium (Expression systems). Sf9 cells were left for seven days at 27 °C without agitation ...
-
No products found
because this supplier's products are not listed.
D.M. Jeziorska, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 6 or 7 of embryoid body culture (Extended Data Fig. 4) was done using Imaris (version 9.1.2, Oxford Instruments). Intensity of transcription spots were quantified using the ‘Spots’ tool calculated as the mean of pixels within an ovoid shape of 1 μm x 1 μm x 3 μm in size (x,y,z dimensions respectively) ...
-
No products found
because this supplier's products are not listed.
Wakana Sato, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... The readings were performed by measuring the luminescence of all the wavelengths with readings “6” and photomultiplier tube (PMT) setting “medium” ...
-
No products found
because this supplier's products are not listed.
Alyssa Huff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1.5 CaCl2, 30 D-glucose) equilibrated with carbogen (95% O2, 5% CO2) by a peristaltic pump (Dynamax RP-1, Rainin Instrument Co; Emeryville CA, USA). As previously published (figure 6a (Huff et al. ...
-
No products found
because this supplier's products are not listed.
Madison Goforth, et al.,
bioRxiv - Microbiology 2023
Quote:
... 1.25 µL of pPNA blocker (5 µM; chloroplast blockers; PNA Bio), 6.5 µL of PCR grade nuclease-free water (Qiagen) ...
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Sofia Nasif, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2×105 cells per well were seeded into a 6-well plate and transfections were performed using the Lullaby transfection reagent (OZ Biosciences). Transfection complexes were prepared in Opti-MEM™ (Gibco ...
-
No products found
because this supplier's products are not listed.
Gregory J. Smith, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
PBS or clodronate (5 mg/ml) containing liposomes (Liposoma, Amsterdam, The Netherlands) were administered to mice by oropharyngeal aspiration on day 5 of the ozone exposure protocol ...
-
No products found
because this supplier's products are not listed.
Ravi K.R. Marreddy, et al.,
bioRxiv - Microbiology 2020
Quote:
... Other species were routinely grown in Brucella agar supplemented with 5% (v/v) defibrinated sheep blood (Hardy Diagnostics), 5 mg/L Hemin and 10 mg/L vitamin K1 ...