-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
This enzyme is part of the pathway from urate to (S)-allantoin, which is present in bacteria,...
Cat# EXWM-4847,
100 ug, contact supplier for pricing
Ask
Hui Tian, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and after 2 h of incubation 3 μL of chitinase from Clostridium thermocellum (Creative Enzymes, New York, USA) was added into the appropriate wells ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... a sub-sample of whole blood was stored on ice and processed within 4 hours with the Hemavet 950 (Drew Scientific) to give 20 whole blood count parameters ...
-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Hongbing She, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR was performed in a total reaction volume of 10 μL containing 5 μL 2×Taq Master Mix (CoWin Biosciences, China), 0.25 μL forward and reverse primer ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Alpha-2-macroglobulin was purchased from Athens Research and was activated by methylamine as described (Ashcom et al. ...
-
No products found
because this supplier's products are not listed.
Yukari Nagatoshi, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Samples of 1 to 2 mg were weighed using a microbalance (BM-22; A&D Company Limited, Japan) and analyzed for total N content using an NC analyzer (Series II CHNS/O Analyzer 2400 ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Clémence Boutry, et al.,
bioRxiv - Microbiology 2022
Quote:
... and on 2 June (only ‘Otava’, ‘Rajika’, ‘Rubinola’, and ‘Boskoop’). Trees with spore traps were excluded from receiving fungicide treatments in 2019 and 2020 ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Nathan Jariwala, et al.,
bioRxiv - Cell Biology 2023
Quote:
... hyaluronic acid (Corgenix 029-001) and decorin (R&D Systems DY143 ...
-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
Daniel Roderer, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... were immobilized on commercial N-hydroxysuccinimide (NHS) ester-activated microarray slides (CodeLink Activated Slides; SurModics, Eden Prairie, MN, USA) using a piezoelectric spotting device (S3 ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Lucy I. Crouch, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Control samples were digested with PNGase F (1 μl, 5 mU, QA-Bio) For Pngase-003341 the final enzyme concentration was 1 μM ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Joshua G. Liang, et al.,
bioRxiv - Immunology 2020
Quote:
Endo180-Fc expression vector was generated by subcloning a PCR amplified cDNA encoding soluble human Endo180 (amino acid residue 1-1394) (19) into the HindIII site of pGH-hFc expression vector (GenHunter Corporation) to allow in-frame fusion to human IgG Fc ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... EPA 200.7 standard 6 purchased from High-Purity Standards was used for calibration ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Sarah C. Donnelly, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples containing 1–3 mg/mL of protein were evaluated using ICP-MS (Biotron Analytical Services, Western University, London, Canada). Briefly ...
-
No products found
because this supplier's products are not listed.
Lucia Sedlackova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM NR (ChromaDex), 10 μM olaparib (Cambridge Biosciences) ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
Zhiyi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... NIH/3T3 SMAD2/3-luciferase reporter cell line (Signosis) was co-cultured with BALF ...
-
No products found
because this supplier's products are not listed.
Rueyhung R. Weng, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5% human platelet lysate (PLS1, Compass Biomedical), 70 ng/mL IL-15 (AF-200-15 ...
-
No products found
because this supplier's products are not listed.
Rishel B. Vohnoutka, et al.,
bioRxiv - Biochemistry 2021
Quote:
Periodic Acid Schiff Staining with and Without Diastase: All reagents were obtained commercially from Rowley Biochemical Inc (Danvers ...
-
Cat# ACT-USI-UP,
USD $367.74/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... magnetic beads were conjugated with monoclonal capture antibodies (mAB47:3, UmanDiagnostics), incubated with diluted mouse serum (1:8 or 1:16 dilution ...
-
No products found
because this supplier's products are not listed.
Jessica D. Warren, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Paclitaxel (Taxol) was used at 5 nM (Biotang). The following drugs were also used at the specified concentrations ...
-
No products found
because this supplier's products are not listed.
Kazuya Matsuo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Human frozen brain sections (5–10 μm thickness) were obtained from BioChain Institute and a part of them were treated with RNase A ...
-
No products found
because this supplier's products are not listed.
Safwan K. Elkhatib, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... and plasma were assessed using 3-CAT research ELISA (Rocky Mountain Diagnostics, BAE-5600, Colorado Springs, CO, USA) which had a corrected NE lower limit of detection of 30 pg/mL ...
-
No products found
because this supplier's products are not listed.
Kevin G. Burt, et al.,
bioRxiv - Bioengineering 2023
Quote:
... IVDs were cultured in DMEM/F12 with 5% Fetal Bovine Serum (FBS, Crystalgen, Cat #FBS-500HI) and 1 % Penicillin-Streptomycin ...
-
No products found
because this supplier's products are not listed.
Rayan Haroun, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mambalgin-1 (Smartox) was dissolved in PBS and was used at a dose of 34µM via intrathecal injection ...
-
No products found
because this supplier's products are not listed.
Sayak Mukhopadhyay, et al.,
bioRxiv - Microbiology 2024
Quote:
We washed the cell culture twice in motility buffer (MB) at 1500 g for 5 min in a centrifugation unit (Scilogex SCT412). The supernatant was discarded ...
-
No products found
because this supplier's products are not listed.
Krissie Tellez, et al.,
bioRxiv - Physiology 2019
Quote:
... Plasma GLP-1 levels were quantified with an active GLP-1 ELISA (Eagle Biosciences). Plasma amino acid levels were determined using the L-Amino Acid Quantitation Kit (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Enikő Lázár, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... 1 U/µl RiboProtect (BLIRT, RT35), 1.0 U/µl T4 Rnl2 (NEB ...
-
No products found
because this supplier's products are not listed.
Rebecca Guth-Metzler, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1 µL of each reverse transcription was combined with 1 µL GenefloTM 625 size standard ROX ladder (CHIMERx) and 20 µL HiDi (Applied Biosystems) ...
-
No products found
because this supplier's products are not listed.
Florencia Rammauro, et al.,
bioRxiv - Microbiology 2024
Quote:
... Cells were further incubated 1 h at RT with monoclonal antibodies anti-p24 (BLV3, 1/200, VMRD, USA). After three washes with PBS ...
-
No products found
because this supplier's products are not listed.
Rahul Sharma, Martin W. Hetzer,
bioRxiv - Cell Biology 2022
Quote:
... mouse Nesprin3 (Nordic-MUBio # MUB1317P,1:250); rabbit Emerin D3B9G XP (CST # 30853) ...
-
No products found
because this supplier's products are not listed.
Peng V. Wu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK19 (rabbit, 1:100, Abbomax 602-670), Ki-67 (rat ...
-
No products found
because this supplier's products are not listed.
Ming Yang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-total Rac1 (1:10; NewEast Biosciences); mouse anti-CD44 (1:100 ...
-
No products found
because this supplier's products are not listed.
Gurman Kaur, et al.,
bioRxiv - Immunology 2021
Quote:
... and 2.8 µl of 1 M Trehalose (Life Sciences Advanced Technologies), followed by incubation at 72°C for 3 min and placing on ice ...
-
No products found
because this supplier's products are not listed.
Cecilie Knudsen, et al.,
bioRxiv - Immunology 2022
Quote:
... before being diluted 1:5000 in HRP-StabilPlus buffer (KemEnTec, 4530A).
-
No products found
because this supplier's products are not listed.
Paul Batty, et al.,
bioRxiv - Cell Biology 2023
Quote:
... NIPBL was detected using a rat monoclonal antibody (Absea, 010702F01, 1:500). Sororin was detected using a custom rabbit antibody (1:500) ...