-
No products found
because this supplier's products are not listed.
Scarlett J Barker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5-Ethylthio-1H-tetrazole (ETT, Honeywell Research Chemicals, 0.25 M solution in acetonitrile) was used as an activator ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Mohd Ibrahim, et al.,
bioRxiv - Biophysics 2023
Quote:
... and (6Z,9Z,28Z,31Z)-heptatriacont-6,9,28,31-tetraene19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3, liquid oil, >98%) was purchased from Biorbyt (Cambridge, UK). Chloroform (>99.8%) ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Junfeng Shi, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4h post 1.4Gy total body irradiation using the RS2000 Pro irradiator (Rad Source, Buford, GA, USA). The engraftment levels of hCD45+ cells were determined 12 weeks post-HPSCs transplantation by flow cytometric quantification of peripheral blood human CD45+ cells ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Benjamin P. Brown, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... L747_A750>P (#E10-12MG, lot G1200-3), and L747_E749 (#E10-12LG, lot G1344-5) were purchased from SignalChem. The Promega ADP-Glo™ kinase assay kit was used to quantify the amount of ADP produced by each EGFR variant in 1XBFA buffer and in the presence or absence of erlotinib at varying concentrations ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Isabella Vlisidou, et al.,
bioRxiv - Microbiology 2019
Quote:
... were added to one BioPORTER tube (Genlantis) and resuspended in 920 μl of DMEM ...
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... One step luciferase assay kit from BPS Bioscience was used for detection ...
-
No products found
because this supplier's products are not listed.
Krista L. Newell, et al.,
bioRxiv - Immunology 2021
Quote:
... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
No products found
because this supplier's products are not listed.
Edmée Eyraud, et al.,
bioRxiv - Pathology 2023
Quote:
... Dutscher) and the wells were coated for 1h at room temperature with poly-lysine-ethylene glycol (PEG-PLL, SuSoS, Dübendorf, Switzerland) to prevent cell adhesion ...
-
No products found
because this supplier's products are not listed.
Lili Qin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... DCs were collected and cocultured with autologous CD8+ T cells with the ratio between 1:4 to 1:10 in AIM-V medium with 5% autologous serum and 30 ng/ml IL-21 (Cellgenix, Germany). Two days later ...
-
No products found
because this supplier's products are not listed.
Aline Sardinha-Silva, et al.,
bioRxiv - Immunology 2024
Quote:
... and/or with 10 μg of both combined recombinant mouse IL-4-Fc and IL-13-Fc (5 μg of each) (Absolute Antibody) every other day for 10 days (5 treatments) ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
One or two liters of Trichoplusia (Tni) cells (Expression System) were infected with recombinant baculoviruses at a cell density of 1.5-2.0 × 106 cells per mL ...
-
No products found
because this supplier's products are not listed.
Briana C. Bywaters, et al.,
bioRxiv - Biophysics 2023
Quote:
... Cells were then seeded (passage 5) on soft (4 kPa) or stiff (50 kPa) polyacrylamide hydrogels coated with 0.2% collagen I (Matrigen, San Diego, CA) at a density of 40x104/18mm2 and cultured for 24 hours ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Blots were blocked in blocking buffer for 1 hour at room temperature and probed overnight at 4°C for PER2 (1:1000 in 5% BSA and TBST; Alpha Diagnostic Intl., Inc., #PER21-A), BMAL1 (1:1000 in 5% BSA and TBST ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Junying Zheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... in 6 ml hibernate without calcium (BrainBits, cat. no. HACA) with 15 μl 0.5mM Glutamax ...
-
No products found
because this supplier's products are not listed.
G. Uppal, et al.,
bioRxiv - Biophysics 2020
Quote:
... The PEG-RGD and 4-arm PEG-acrylate (4-PEG-ACR, 20kDa, JenKem Technology) were mixed at a 1.5:8.5 (w/w ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Miguel Ricardo Leung, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-SPACA9 (HPA022243 from Atlas Antibodies, used at 6 μg/mL), or no primary antibody diluted in blocking buffer for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Qiong Wang, et al.,
bioRxiv - Immunology 2019
Quote:
One immunization to induce CIA : Bovine type II collagen (2 mg/ml, Chondrex, cat. # 20021) and complete Freund’s adjuvant (4mg/ml M ...
-
No products found
because this supplier's products are not listed.
L Pérez-Sisqués, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mice sacrificed one week after behavioral testing with FD Rapid GolgiStain™kit (FD Neurotechnologies) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Luca Tadini, et al.,
bioRxiv - Plant Biology 2019
Quote:
... AtHsc70-4 antibody from Antibodies-online, RpoTp (PHY0835S ...
-
No products found
because this supplier's products are not listed.
Craig T. Connors, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 6 weeks-of-age were analyzed by ELISA for insulin (Alpco) and glucagon content (Mercodia) ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Marie-Françoise Montaron, et al.,
bioRxiv - Neuroscience 2020
Quote:
One-of-ten series was incubated with a rat monoclonal anti-BrdU antibody (1/200, Accurate Chemical) and with a mouse monoclonal anti-NeuN antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... and 5 µg cholera toxin (List Labs; 100B) in PBS ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... containing 5% (v/v) FCS and incubated overnight in a humidified atmosphere at 37°C and 5% CO2 (Nuaire, DH Autoflow). After 24 hours 1.5mL of the media was removed and media with herb extract or media only control was added ...