-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Ryan Murray, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were washed and cryopreserved in a 1:1 mixture of CS10 (BioLife Solutions) and Plasma-Lyte A (Hanna Pharmaceutical) supplemented with 2% HSA (Access Biologicals). Cryopreserved cells were thawed and activated with anti-CD3/anti-CD28 TransAct (Miltenyi ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interleukin 6 (IL6) ELISA Kit (RD-IL6-Mu, Reddot biotech), Mouse Interferon Gamma Induced Protein 10kDa (IP10 ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Immunofluorescent staining of either differentiating cells in ALI wells or of the paraffin embedded human bronchus from healthy nonsmokers (Donor 1: Age 27, Female; Donor 2: Age 40, Female and Donor 3: Age 27, Female; catalog number HuFPT111, US Biomax, Inc., Rockville, MD, USA), or mouse trachea (C57BL/6 ...
-
No products found
because this supplier's products are not listed.
Angela Lai, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Blood samples were collected at the inlet and outlet for measuring blood cell count (2 mL in K2EDTA) and aPTT/PT (3 mL in 1:9 citrate) using a clinical hematology analyzer (Diagnostica Stago Start 4, Siemens, Germany).12 If aPTT was outside the range of 20-50 seconds ...
-
No products found
because this supplier's products are not listed.
Takashi Furusawa, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... obtained from Cambridge Isotope Laboratory (Andover, MA) as well as 13C6-glucose-6-phosphate and 13C6-fructose-1,6-diphosphate purchased from Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Abdugaffor Ablazov, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Approximately 20 mg of lyophilized rice samples were extracted twice with 2 mL of ethyl acetate containing 2 ng of D3-zaxinone (customized synthesis; Buchem B.V., Apeldoorn, The Netherlands). After that ...
-
No products found
because this supplier's products are not listed.
Camila Ribeiro, et al.,
bioRxiv - Plant Biology 2020
Quote:
... plants were painted with a 2% glufosinate-ammonium (Bio-world), and non-transgenic segregants were removed (56) ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Lucas Ferguson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... from 6 mL of polysome buffered 10% (w/v) D-sucrose and 6 mL of polysome buffered 50% D-sucrose solution using the Gradient Master (BioComp Instruments). Using a wide-bore pipette tip ...
-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Kristi Dietert, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A total of 21,600 cells were plated onto the upper wells (n=6/condition) of 96-well poly-l-ornithine (PLO) coated chemotaxis chambers (10 μm pore size, Neuro Probe Inc) and maintained in DMEM containing l-glutamine (1 mM) ...
-
No products found
because this supplier's products are not listed.
Yalda Afshar, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Confluent endothelial monolayers were grown on tissue culture treated 6-well plates (Falcon #08-772-1B) in complete MCDB-131 media (VEC Technologies # MCDB131-WOFBS) plus 10% FBS (Omega Scientific #FB-11 ...
-
No products found
because this supplier's products are not listed.
Colin Kremitzki, et al.,
bioRxiv - Genetics 2023
Quote:
Lentiviruses carrying the gRNA libraries were packaged into 8×106 HEK 293T cells/well in a 6-well plate (TPP92006, MIDSCI, Fenton, MO, USA), using the TransIT Lentivirus transfection reagent (MIR 6600 ...
-
No products found
because this supplier's products are not listed.
AL Seufert, et al.,
bioRxiv - Immunology 2022
Quote:
... 2% endotoxin- and fatty acid-free bovine serum albumin (BSA; Proliant Biologicals) and 10% M-CSF ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
A Prabhakar, et al.,
bioRxiv - Immunology 2021
Quote:
... 2-3 ml blood was collected in RNAgard blood tubes (Biomatrica, USA) and stored in −80°C until RNA precipitation ...
-
No products found
because this supplier's products are not listed.
Aditya R. Yelamali, et al.,
bioRxiv - Immunology 2024
Quote:
... streptavidin-azide (SAv-azide; 2-4 azide groups per tetramer, Protein Mods) at 2-5 mg/mL stock concentration in PBS was prepared for payload conjugation by first adding DMSO to 20% final concentration as cosolvent.
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2-axis computer-controlled stepping motor system (4”× 3” XY; Prior Scientific, Jena, Germany), focus encoder (Heidenhain ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Angelo D’Alessandro, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Lysed RBCs were then mixed 1:1 with Hemoglobind (Biotech Support Group), followed by end over end rotation for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Amelia R. McCready-Vangi, et al.,
bioRxiv - Microbiology 2022
Quote:
... followed by the addition of 20 μL plasmin specific chromogenic substrate S-2251(H-D-Val-Leu-Lys-paranitroanilide, 2 mmol/L, Chromogenix) to each well ...
-
No products found
because this supplier's products are not listed.
Franz Meitinger, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... AZD1390 (ATMi; 1 μM; Chemgood LLC); Palbociclib (CDK4/6i ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... sections were pre-incubated in 4% PFA (in 0.1 M PB) for ≥2 days at 4°C before processing with the FD NeuroSilver™ kit II (FD Neurotechnologies, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Nanoparticle tracking analysis (NTA): 1 μL A549 EVs (1 mg/ml; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were diluted (1:1000 ...
-
No products found
because this supplier's products are not listed.
Sylvain Perriot, et al.,
bioRxiv - Immunology 2024
Quote:
... -C (1:500, AffinityImmuno, clone W6/32) were incubated in 250ul blocking buffer with neurons overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Ellen Gingrich, Kendra Case, A. Denise R. Garcia,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-BrdU (1:500, Maine Biotechnology Services), mouse anti-CC1 (1:1k ...
-
No products found
because this supplier's products are not listed.
Chuan Liu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... diluted 1:60 or porcine kidney ECM (Xylyx Bio ...
-
No products found
because this supplier's products are not listed.
Yann-Ru Lou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1:1 v/v) and loaded to the silica gel column (100 g, 200-425 mesh, 60 A, Jade Scientific Inc, Westland, MI, USA) packed with ethyl acetate/hexane (200 mL ...
-
No products found
because this supplier's products are not listed.
Sung Hee Ko, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analyzed by electrophoresis with precast 1% agarose gel (Embi Tec) or the Agilent High Sensitivity DNA kit (5067-4626 ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... applying polyclonal anti-human epidermal transglutaminase (TG3) antibody (Zedira; 1/2000), monoclonal anti-TG4 antibody (Covalab ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...