-
No products found
because this supplier's products are not listed.
Cassandra M. Stawicki, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Aliquots of 2-5 µl of sample were added to 700 µl of 2% PBS and loaded into a cuvette (BrandTech Scientific, 759150). Zeta potential was measured in Folded Capillary Cell cuvettes (Malvern ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Juan Feng, et al.,
bioRxiv - Immunology 2021
Quote:
Heavy and light chain V region cDNA sequences of mAbs 2/6.14 and 2/1.12 were determined by Syd Labs (Natick, MA). The mAbs each have γ1 heavy and κ light chains and unique V regions as shown by BLAST searches ...
-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... day 0 and day 21) with 5 μg/dose of recombinant SARS-CoV-2 Spike protein (S1+S2 extracellular domain) (Bon Opus Biosciences, #BP040) adjuvanted with 100 μg/dose alhydrogel adjuvant 2% (InvivoGen ...
-
Requires Mg2+ for maximal activity. This enzyme is involved in the biosynthesis of vitamin K2...
Cat# EXWM-2036,
100 ug, contact supplier for pricing
Ask
Junfei Ma, Shuying Wang, Qianyu Ji, Qing Liu,
bioRxiv - Immunology 2021
Quote:
... pylori urease (2 μg in 50 μL, Creative Enzymes, USA) was incubated with purified IgG antibodies (64 μg/well ...
-
No products found
because this supplier's products are not listed.
Satsuki Tsuji, Naoki Shibata,
bioRxiv - Molecular Biology 2024
Quote:
... 2 μm (Track-Etched Membrane PCTE filter; GVS Japan, Tokyo, Japan), and 0.7 μm (GF/F glass-fiber filter ...
-
Cat# AB-307,
100 micrograms,USD $565.0
Ask
Savannah Barnett, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Hcrt-SAP (hypocretin-2-saporin, Advanced Targeting Systems, San Diego, CA, USA). The method of stereotaxic injection was similar to those described in our previous study and will be brief here (Nattie et al. ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
CIC were determined by 2 different ELISA’s from Quidel (San Diego, CA): the CIC-C1q enzyme immunoassay is based on the principle that complement fixing IC will bind to immobilized human C1q purified protein ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Chandrashekhar D. Borkar, et al.,
bioRxiv - Neuroscience 2023
Quote:
... retrogradely transported beads (0.2 μl, 1:2 diluted with saline, Lumafluor Inc., Durham, NC) were stereotaxically injected into the respective brain regions ...
-
No products found
because this supplier's products are not listed.
Anne R. Shim, et al.,
bioRxiv - Biophysics 2024
Quote:
... with 2 µL of a Chromosome 3 Control probe (Empire Genomics, #CHR03-10-RE). Samples were protected from light from hereon ...
-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2-axis computer-controlled stepping motor system (4”× 3” XY; Prior Scientific, Jena, Germany), focus encoder (Heidenhain ...
-
No products found
because this supplier's products are not listed.
Nathan Jariwala, et al.,
bioRxiv - Cell Biology 2023
Quote:
... hyaluronic acid (Corgenix 029-001) and decorin (R&D Systems DY143 ...
-
No products found
because this supplier's products are not listed.
Mustafa G. Aydogan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2) The mCherry tag was replaced with either mNeonGreen (Shaner et al., 2013) (Allele Biotechnology) or mKate2 (Shcherbo et al. ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... (6) was purchased from GenTarget Inc.
-
No products found
because this supplier's products are not listed.
Naomi-Liza Denning, et al.,
bioRxiv - Immunology 2019
Quote:
... Macrophages from healthy human donors were obtained from Hemacare (Cat. No. PBMACC-MON-2, Northridge, CA). Murine peritoneal macrophages were isolated from adult male mice38 ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
384-well plates were coated with 2 μg/mL of YFV E protein (Meridian Life Science) at 25 μL/well and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Nikhil Pandey, Priyanka Mishra,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The intensity of COX-2 was determined using image quant Omega Flour TM (GEL Company, USA) using Omega Fluor Acquisition software ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Eugene Kim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and for acute phase protein α-2-macroglobulin using an ELISA kit (Life Diagnostics Inc., West Chester, USA).
-
No products found
because this supplier's products are not listed.
Yukari Nagatoshi, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Samples of 1 to 2 mg were weighed using a microbalance (BM-22; A&D Company Limited, Japan) and analyzed for total N content using an NC analyzer (Series II CHNS/O Analyzer 2400 ...
-
No products found
because this supplier's products are not listed.
Anna Zagórska, et al.,
bioRxiv - Physiology 2020
Quote:
... in saturated aqueous solution of Picric Acid (LabChem)) ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Ben J. G. Sutherland, et al.,
bioRxiv - Genetics 2020
Quote:
... was conducted using the HAT-F/HAT and NAT collections in Table 2 combined by source type (HAT-F/HAT vs. NAT) as a multi-locus genotype-environment association (GEA) using vegan v2.5-5 (Oksanen et al. ...
-
No products found
because this supplier's products are not listed.
Stephanie H Chen, et al.,
bioRxiv - Genomics 2021
Quote:
... A pilot run on an Illumina iSeq 100 with 2 x 150 bp paired end sequencing run was performed for QC using hic_qc v1.0 (Phase Genomics, 2019) with i1 300 cycle chemistry ...
-
No products found
because this supplier's products are not listed.
Natalie C. Butterfield, et al.,
bioRxiv - Genetics 2019
Quote:
... harboring alanine/alanine or threonine/threonine polymorphisms for the deiodinase 2 gene at codon 92 (Dio2Ala92, n=9 and Dio2Thr92, n=10) were generated by Applied Stemcell Inc ...
-
No products found
because this supplier's products are not listed.
Anne-Stéphanie Rueff, et al.,
bioRxiv - Microbiology 2023
Quote:
... bacteria were harvested at OD595nm of 0.1 and incubated with 1/1000 of Pneumococcus type 2 Rabbit antiserum (SSI Diagnostica, 16745) for 5 min on ice ...
-
No products found
because this supplier's products are not listed.
Marta Napiorkowska, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 30 min) and the cell-free extract was loaded onto column packed with 2 mL Super Ni-NTA matrix (Protein Ark) pre-equilibrated with 3 column volumes (CV ...
-
No products found
because this supplier's products are not listed.
Cristina Godinho-Silva, et al.,
bioRxiv - Immunology 2019
Quote:
... Whole-mount samples were incubated overnight or for 2 days at 4°C using the following antibodies: anti-Tyrosine hydroxylase (TH) (Pel-Freez Biologicals) and anti-GFP (Aves Labs) ...
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from each cornea were seeded equally across 2 wells of a 24-well plate coated with fibronectin collagen (FNC) coating mix (Athena Enzyme Systems) in M5 stabilization media (human endothelial SFM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Gaurang Patel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... followed by 20 minutes of boiling at 90°C in Pretreat 2-target retrieval buffer treatment (ACD, 320043) in Oster Steamer (IHC World, LLC, Model 5709) and 30 minutes of Pretreat 3-using protease plus treatment (ACD ...
-
No products found
because this supplier's products are not listed.
Pranjali Beri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The uncured LSR was vulcanized at 150°C for 2 minutes using a hydraulic lab press equipped with heated platens (Carver Bench Top Auto Press) then demolded from the tool.
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Immunofluorescent staining of either differentiating cells in ALI wells or of the paraffin embedded human bronchus from healthy nonsmokers (Donor 1: Age 27, Female; Donor 2: Age 40, Female and Donor 3: Age 27, Female; catalog number HuFPT111, US Biomax, Inc., Rockville, MD, USA), or mouse trachea (C57BL/6 ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Héctor M Ramos-Zaldívar, et al.,
bioRxiv - Neuroscience 2024
Quote:
... or a carboxylic acid group (HS-PEG-COOH MW 5K, JenKem Technology, TX, USA) at the other ...
-
No products found
because this supplier's products are not listed.
Anna M. O’Brien, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Hydrochloric acid (36.5% to 38.0% solution in water) was purchased from Caledon Laboratories (Georgetown, Canada). Milli-Q (18.2 MΩcm ...
-
No products found
because this supplier's products are not listed.
Dillon K. Jarrell, et al.,
bioRxiv - Bioengineering 2020
Quote:
P3-5 GFP-HUVECs (Angio-Proteomie cAP-0001GFP) and P3-5 human dermal fibroblasts (HDFs ...
-
No products found
because this supplier's products are not listed.
Kazuya Ishikawa, et al.,
bioRxiv - Microbiology 2022
Quote:
... The membrane was treated with 1:1000 anti- lipoteichoic acid antibody (clone 55, Hycult Biotech, Uden, The Netherlands) and washed 3 times with phosphate buffered saline ...
-
No products found
because this supplier's products are not listed.
Kevin N. Lin, Albert J. Keung, James M. Tuck,
bioRxiv - Synthetic Biology 2019
Quote:
Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... A549 EVs (100 μg; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were lysed and processed according to the manufacturer’s guidelines and the developed dot blot array was imaged using a ChemiDoc imaging system (Bio-Rad Laboratories Inc. ...
-
No products found
because this supplier's products are not listed.
Kristi Dietert, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A total of 21,600 cells were plated onto the upper wells (n=6/condition) of 96-well poly-l-ornithine (PLO) coated chemotaxis chambers (10 μm pore size, Neuro Probe Inc) and maintained in DMEM containing l-glutamine (1 mM) ...
-
No products found
because this supplier's products are not listed.
Qiang Li, et al.,
bioRxiv - Genomics 2021
Quote:
... were first treated with oxygen plasma for 5 mins (Anatech Barrel Plasma System, 100W, 40% O2) followed by methacryloxypropyltrimethoxysilane (Bind-Silane ...
-
No products found
because this supplier's products are not listed.
Markus Hackl, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The NTA modified primer (backward primer, 5’-NTA-SS-C6-TCCAAAGGTGAAGAACTGTTCACC) was purchased from Gene Link, Inc ...
-
No products found
because this supplier's products are not listed.
Shruti D Shah, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... samples were embedded in paraffin and sectioned at 5 microns on Starfrost adhesive slides (Mercedes Medical; Catalog #MER 7255/90/WH). Slides were deparaffinized in three xylene baths and then rehydrated in graded 100% to 70% alcohols ...