-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... phenazine-1-carboxylic acid (PCA, Ark Pharm); phenazine-1-carboxamide (PCN ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Héctor M Ramos-Zaldívar, et al.,
bioRxiv - Neuroscience 2024
Quote:
... or a carboxylic acid group (HS-PEG-COOH MW 5K, JenKem Technology, TX, USA) at the other ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Christopher W. Thomas, et al.,
bioRxiv - Neuroscience 2021
Quote:
Psilocin (4-hydroxy-N,N-dimethyltryptamine, LGC Standards) was administered by intraperitoneal injection at a dose of 2 mg/kg ...
-
No products found
because this supplier's products are not listed.
Roslyn A. Taylor, et al.,
bioRxiv - Cell Biology 2021
Quote:
... DOTA-NHS-ester (Macrocyclics, Dallas, Texas) was dissolved in the 0.1 M sodium phosphate buffer ...
-
No products found
because this supplier's products are not listed.
Filippo Macchi, Eric Edsinger, Kirsten C. Sadler,
bioRxiv - Genomics 2022
Quote:
... or anti-5-methyl-cytosine (5mC – Aviva Biosystem clone 33D3 ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Daniel D. Lam, et al.,
bioRxiv - Genetics 2021
Quote:
... cells were stained with methyl green pyronin (Dianova). In the case of efficient lysis ...
-
No products found
because this supplier's products are not listed.
Yanwen Fu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.3% Hydroxypropyl Methyl Cellulose (HPMC) (cat# H1335, Spectrum Chemical), pH 5.8).
-
No products found
because this supplier's products are not listed.
Derek A. Rinaldi, et al.,
bioRxiv - Biophysics 2023
Quote:
... DNP-Peg12-NHS ester was purchased from BroadPharm (BP-22397). All live-cell RBL imaging was performed in modified Hank’s buffered salt solution (additional 10 mM Hepes ...
-
No products found
because this supplier's products are not listed.
Meitham Amereh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Citric acid monohydrate (CAS# 5949-29-1) and sodium citrate (CAS# 6132-04-3) from Bio basic Canada Inc ...
-
No products found
because this supplier's products are not listed.
Rachel E. Young, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The apparent pKa of LNPs was determined via TNS [6-(p-toluidinyl)naphthalene-2-sulfonic acid] (Thomas Scientific, Swedesboro, NJ) assays ...
-
No products found
because this supplier's products are not listed.
Wenyang Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Blots were washed 3 times with Tris Buffered Saline-Tween (TBST) buffer (Boston BioProducts, Cat. # IBB-181–6) and developed using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Rasmus Ree, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Couplings were performed using 3-6 equivalents Fmoc-amino acid/TBTU and 6-12 equivalents N-methylmorpholine on the following resin: Tentagel S Trityl resin (RAPP Polymere, Germany), loading ...
-
No products found
because this supplier's products are not listed.
Kai Qiao, Lydia M. Le Page, Myriam M. Chaumeil,
bioRxiv - Biochemistry 2020
Quote:
... prepared as previously described25) was polarized for 1h on a Hypersense dDNP polarizer (Oxford Instruments), then dissolved in 4.5mL or 3.5mL buffer (pyruvate buffer ...
-
No products found
because this supplier's products are not listed.
Ana Cristina Colabardini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cell lysis was processed by 6 times beating for 3 minutes with ∼100 μl volume of silica beads using Bullet Blender (Next Advance) with at least 3 minutes of cooling in between each cycle ...
-
No products found
because this supplier's products are not listed.
Emma A. Quinn, et al.,
bioRxiv - Microbiology 2021
Quote:
... PCR products were visualised using 2 % (w/v) agarose/TBE gels stained with 3 μL Greensafe premium nucleic acid stain (NZYTech, Lisboa, Portugal). TBE gels consisted of 100 mL 1x TBE buffer ...
-
No products found
because this supplier's products are not listed.
Rachel Bezalel-Buch, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 39mer 8 atom 6 bp ICL (39+6 DMEDA ICL) were synthesized and purified as previously reported (33) ...
-
No products found
because this supplier's products are not listed.
Bao Gia Vu, W. Scott Moye-Rowley,
bioRxiv - Genetics 2021
Quote:
... or under amino acid-selective conditions in complete supplemental medium (CSM) (Difco yeast nitrogen extract without amino acids, amino acid powder from Sunrise Science Products, 2% μg/ml nourseothricin (Jena Bioscience ...
-
No products found
because this supplier's products are not listed.
Aldo S. Bader, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The agarose plugs were allowed to solidify at 4°C for 1h before being immersed in lysis buffer (Trevigen) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Silvia Ceschi, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1% non-essential amino acids (Euroclone) and 1% penicillin/streptomycin (Euroclone) ...
-
No products found
because this supplier's products are not listed.
Ricardo Cruz-Acuña, et al.,
bioRxiv - Bioengineering 2022
Quote:
... sodium hyaluronic acid (NaHA; Lifecore Biomedical) was converted to its tetrabutylammonium salt (HA-TBA ...
-
No products found
because this supplier's products are not listed.
Xiao-Jun Xiang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Then the sections were incubated in 0.3% Triton X-100 in 0.05M PB for 1h and in Streptavidin-Biotin Complex solution (SABC kit, Boster Biological Technology) for 3h at room temperature in sequence ...
-
No products found
because this supplier's products are not listed.
Xiaowei Gai, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-6 (Lot: 449268JEI6, Elabscience, China), and IL-10 (Lot ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Vineet Choudhary, et al.,
bioRxiv - Cell Biology 2020
Quote:
... an amino acid mix (United States Biologicals), containing either 2% glucose ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... and incubated for at least 1h prior to microinjection on a hot plate (38°C) under mineral oil (FUJIFILM Irvine Scientific; 9305). Oocytes were then microinjected with ~5 pl of mRNAs in M2 medium with 2.5 mM milrinone and 3mg/mL BSA at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Allison Sharrar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... C57BL/6 mouse primary hepatocytes (Cell Biologics) were thawed and plated in 96 well tissue culture plates ...
-
No products found
because this supplier's products are not listed.
Alan Bush, et al.,
bioRxiv - Neuroscience 2021
Quote:
... strips with 54 or 63 contacts each (platinum 1 mm disc contacts arranged in a 3×18 or 3×21 layout, with 3 mm center to center spacing, PMT Cortac Strips models 2110-54-001 and 2011-63-002 ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Cody Moore, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or recombinant ATF-6 Beta (Abnova H00001388-Q01). Wild-type HEK293T lysate (Origene LY500001 ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus wood particles were decomposed with a mixture (20 mL) of acetic acid containing 1% peracetic acid using a microwave reactor (Biotage Initiator Plus) at 50 ...
-
No products found
because this supplier's products are not listed.
Slawomir Kubik, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and treated with Cap-Clip Acid Pyrophosphatase (Tebu-bio). RNA was then ligated to the biotinylated 5’ adaptor and fragmented for 5 min at 70°C in fragmentation buffer (10mM ZnCl2 ...
-
No products found
because this supplier's products are not listed.
Martin Minařík, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... or a MicroPublisher 6 color CCD camera (Teledyne Photometrics) controlled by Ocular software (Teledyne Photometrics) ...
-
No products found
because this supplier's products are not listed.
Irene Pereira de Sousa, et al.,
bioRxiv - Bioengineering 2019
Quote:
... poly(acrylic acid) 50 kDa (PAA) was purchased from Polyscience Inc ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Leandre M. Glendenning, et al.,
bioRxiv - Immunology 2023
Quote:
Sialic acids were removed from human polyclonal IgG (Innovative Research IHIUGGAP) via recombinant neuraminidase (NEB P0720L ...
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnology, Cat.#21141). Gel imaging was conducted on a Gel Doc XR+ System (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Eric B Knudsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stocks were maintained on 6-well tissue culture treated plates (CELLTREAT) coated with 1% Geltrex (Gibco ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Kevin S. Cannon, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Lipidated YxxΦ-cargo peptide (Oleic acid-S{Lys(FITC))}KVTRRPKASDYQRL) was synthesized by Biomatik. HRV3C protease ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...