-
No products found
because this supplier's products are not listed.
Catherine C. Neto, et al.,
bioRxiv - Microbiology 2021
Quote:
... quercetin-3-O-galactoside or hyperoside (Chromadex, Irvine, CA); procyanidin-A2 (Indofine Inc. ...
-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The estradiol levels (n=4) were also measured using an ELISA assay (#ES180S-100 Calbiotech, detection range 3 to 300 pg/mL). The intra-assay variation was 5.9% in these assays.
-
No products found
because this supplier's products are not listed.
Flávia Viana, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10-4 and 10-6 were automatically plated using easySpiral® automatic plater (Interscience, France) in triplicates on BCYE agar ...
-
No products found
because this supplier's products are not listed.
Greg. A. Timblin, et al.,
bioRxiv - Immunology 2022
Quote:
... 4-phosphopantetheine (CX11340) was from Chiralix. MPLA (tlrl-mpls) ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... HBMECs at density of 3 to 4 × 105/cm2 were seeded onto glass coverslips coated with attachment factor (Cell Systems; Catalogue number: 4Z0-201) within 6-well plates at passage 7 ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
Paola Benaglio, et al.,
bioRxiv - Genomics 2020
Quote:
Peripheral blood mononuclear cells (PBMCs) from 10 individuals (4 females and 6 males) were purchased from HemaCare (Northridge, CA) and profiled for snATAC using 10x Genomics Chromium Single Cell ATAC Solution ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Franziska Herster, et al.,
bioRxiv - Immunology 2019
Quote:
... 4 μg/g of anti-CD42b (clone R300, Emfret Analytics) or rat IgG isotype control (clone R301 ...
-
No products found
because this supplier's products are not listed.
KJ Suchacki, et al.,
bioRxiv - Physiology 2020
Quote:
... 4 μm Diamond Hydride silica column (Microsolv Technologies, NJ, USA) and a linear gradient from 65% buffer B (0.1% formic acid in Acetronitrile ...
-
No products found
because this supplier's products are not listed.
Zi Ye, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Defibrinated sheep blood was stored at 4°C and used within 2 weeks of purchasing (Hemostat Laboratories, Dixon, CA). Human foot odorants were provided as cloth strips cut from socks that had been continually worn for 5 days by a 30-year-old male volunteer and thereafter incubated overnight at 37°C in a sealed Ziploc plastic bag (SC Johnson ...
-
No products found
because this supplier's products are not listed.
Atiq Faramarz, et al.,
bioRxiv - Cell Biology 2019
Quote:
... for 2–4 h and fluorescence (560Ex/590Em) was measured in a microplate reader (TriStar LB 941, Berthold Technologies). To monitor cell growth of RPE1 cells ...
-
No products found
because this supplier's products are not listed.
Rosine Manishimwe, et al.,
bioRxiv - Microbiology 2020
Quote:
... coli were tested for indole production using an indole spot test (Hardy Diagnostics, California, United States) and were confirmed as E ...
-
No products found
because this supplier's products are not listed.
Sophie Girardin, et al.,
bioRxiv - Neuroscience 2021
Quote:
... it was first immersed in a solution of 4 % Tergazyme (Alconox, 1304-1) for 24 h to remove cell culture and proteins ...
-
No products found
because this supplier's products are not listed.
Daphne Bazopoulou, et al.,
bioRxiv - Molecular Biology 2019
Quote:
Worms were mounted on objective slides using 4 μl thermoreversible CyGEL (BioStatus; Fisher Scientific) and 2 μl of 50 mM levamisole for immobilization ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Vincenzo Davide Aloi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and treated overnight at 4°C with the primary antibody (rabbit anti-pERK; 1:200, PhosphoSolutions). The pre-treated sections were then incubated for 2 hours at room temperature with goat anti-rabbit conjugated to Cy3 ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Daniel Segelcke, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Peptides were acidified to a final concentration of 0.1% trifluoro-acetic acid (TFA) for enhanced reversed-phase purification with commercially available C18 columns (UltraMicroSpin, The Nest Group). While non-polar solutes such as peptides were retained ...
-
No products found
because this supplier's products are not listed.
Youichi Tajima, Futoshi Shibasaki, Hisao Masai,
bioRxiv - Cancer Biology 2022
Quote:
... Proteins were separated by SDS-PAGE on 4-20 % gradient precast gel (EZBiolab Precast Gel, WSHT, Shanghai) at 100 V for 75 min ...
-
No products found
because this supplier's products are not listed.
Xiuting Liu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and three doses of clodronate-containing liposomes (Liposoma; 200 μL/each on days 4, 11, and 18). Control mice were treated with same doses/volume of IgG (clone HRPN ...
-
No products found
because this supplier's products are not listed.
Yoko Kagohashi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The band at the 0-4% Ficoll interface was collected using a Piston Gradient Fractionator (BioComp Instruments, Inc). The vacuolar fraction was stored at -75°C ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
Indole Assay Kit
Cat# DIND-100,
1.0 kit, 100 tests, USD $156.0
Ask
Megan K. DeBari, et al.,
bioRxiv - Bioengineering 2021
Quote:
Media was collected on day 4 and glycerol concentrations were measured using a glycerol assay (BioAssay Systems, Hayward, CA). The assay was performed following the manufacturer’s procedure ...
-
No products found
because this supplier's products are not listed.
M. Tomasi, et al.,
bioRxiv - Microbiology 2021
Quote:
... followed by an overnight incubation at +4°C with anti-OVA257-264 Dextramer PE conjugate (SIINFEKL, IMMUDEX, Virum Denmark) diluted 1:30 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Vinay Tripuraneni, et al.,
bioRxiv - Genomics 2019
Quote:
Wild-type cells were grown to an OD600 of approximately 0.2-0.3 in YEP with 2% raffinose and 0.1% dextrose at which point alpha factor was added at a final concentration of 50 ng/ml for 3.5-4 h (GenWay). 20% galactose was added to a final concentration of 2% in the medium to induce HO expression ...
-
No products found
because this supplier's products are not listed.
Nydia Tejeda-Muñoz, Edward M. De Robertis,
bioRxiv - Developmental Biology 2022
Quote:
... In vitro synthesized mRNAs were microinjected in a 4 nl volume using an IM 300 Microinjector (Narishige International USA, Inc). To study the role of ESCRT in development ...
-
No products found
because this supplier's products are not listed.
Miriam Marín-Menguiano, et al.,
bioRxiv - Microbiology 2019
Quote:
ER stress assays were carried out with cultures grown at 28 °C to exponential phase in CMD and spotted at 0.4 OD600 onto CM plates supplemented with 4 mM DTT (iNtRON Biotechnology). Plates were incubated for 48 h at 28 °C ...
-
No products found
because this supplier's products are not listed.
Anitha Shenoy, et al.,
bioRxiv - Cell Biology 2022
Quote:
Collagen staining was performed on 5 μm thick sections of 4% PFA fixed paraffin-embedded lung lobes using Picro-Sirius Red Stain Kit from ScyTek Laboratories Inc ...
-
No products found
because this supplier's products are not listed.
William A. Comrie, et al.,
bioRxiv - Immunology 2019
Quote:
µm in depth with 5.0 µm pores at a density of 4×105 pores/cm2 (Neuro Probe, Inc., Gaithersburg, MD). The filter frame was replaced on the 96-well plate and 25 ul (75,000 cells ...
-
No products found
because this supplier's products are not listed.
Poulomi Das, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The axonemes were removed by centrifugation (27,000 g, 4°C, 15 min) and the supernatant was incubated with anti-NG nanobody agarose beads (Allele Biotechnology) for 1 hour at 4°C using a rotisserie ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Alan P. R. Lorenzetti, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Cell pellets were resuspended in Milli-Q water and disrupted at 4°C using ceramic beads (Mo Bio Laboratories) and a Precellys 24 homogenizer (Bertin Corp). Protein content was determined by bicinchoninic acid assay (BCA ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Lili Zhao, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cell viability was assessed over time for 4 days using the xCELLigence real-time cell analyser system and the RTCA software v1.2.1 (ACEA Biosciences, San Diego, CA, USA). To characterise T-cell activation ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... then stimulated for 3 days in DMEM media supplemented with 10% FBS (Omega Scientific), 1% L-glutamine ...
-
No products found
because this supplier's products are not listed.
Ronan W. O’Connell, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Cato Prince, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 2 mM MgCl2 and 200 U of mSAN nuclease (Arcticzymes catalog #70950-150). Cell lysates were incubated at 37°C for 1 hour ...