-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Rui Sun, et al.,
bioRxiv - Systems Biology 2022
Quote:
... AKT1-2 inhibitor MK-2206 (Targetmol, 1032350-13-2), and everolimus (Targetmol ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Nicole M. Gaudelli, et al.,
bioRxiv - Genomics 2020
Quote:
... and 250IU/mL of recombinant human interleukin-2 (rhIL-2, CellGenix GmbH). Cells were activated with soluble human anti-CD3 (clone OKT3 ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The full cDNA sequence of the lncRNA was then amplified with forward primer: 5’- GTATCATAAGGATCCCTTTCCACTGCTCTGGTGAG-3’ and reverse primer: 5’- GTATCATAAGTCGACCTCACCTAGCTGTCTGTCC-3’ and cloned into pAAV-MCS (Cat#: VPK-410, Cell Biolabs Inc.) using the restriction enzymes BamH I and HindIII sites ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and p-SCN-Bn-TCMC (S-2-(4-Isothiocyanatobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra(2-carbamoylmethyl)cyclododecane) (catalog No. B-1005) were purchased from Macrocyclics, Inc ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Anne-Cathrine Vogt, et al.,
bioRxiv - Immunology 2022
Quote:
Recombinant SARS-CoV-2 spike S1 B.1.1.529-Omicron RBD protein was purchased from (antibodies-online GmbH), recombinant SARS-CoV-2 Spike RBD and recombinant SARS-CoV-2 Spike RBD B.1.617.2 L452R T478K were purchased from R&D systems ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Laurence Abrami, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-Bromopalmitate (2-BP; Focus Biomolecules, FBM-10-3284) at 100 μM at 37°C during the indicated time.
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Jeremy Krohn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti perilipin-2 (Perilipin-2; 1:1000; Progen Cat# GP40, RRID:AB_2895086), mouse anti glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Zhipeng Li, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Solution standard: 2 µl of calibration standard #2 (“CEM2”, LGC Standards #VHG-SM70B-100) was added to 200 µl of 50% HNO3 and heated for 2 hrs at 90°C in a loosely capped 15ml centrifuge tube (VWR ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
Angel K. Kongsomboonvech, et al.,
bioRxiv - Immunology 2020
Quote:
... 2% heat-inactivated FBS (Omega Scientific)] and blocked with blocking buffer [FACS buffer with 5% normal Syrian hamster serum (Jackson Immunoresearch ...
-
No products found
because this supplier's products are not listed.
Anna C. Deleray, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2-hydroxyethyl starch (Spectrum Chemical, H3012) was used.
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Jordana Griffiths, et al.,
bioRxiv - Immunology 2020
Quote:
... Histogram overlays were produced using FCS Express (V.3) software (De Novo Software).
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
A.K. Sulit, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 2/1/56 FAA), and Porphyromonas asaccharolytica (CC44 001F, and CC1/6 F2) using Bacterial Lipopolysaccharides (LPS) Extraction Kit (Alpha Diagnostic International, Catalog # 1000-100-LPS) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Renee L. Hajnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IL-2-APC (Tonbo bioscience, 20-7021) on ice for 30 min ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
because this supplier's products are not listed.
Mahmoud Suliman, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Dialysis was performed against deionized water using Spectra/Por 3 dialysis membrane tubing (Repligen) with a MWCO of 3.5 kDa for 48 hours ...
-
No products found
because this supplier's products are not listed.
Jinbao Liu, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Then the mixture was centrifuged at 200 g for 2 min and the supernatant was transferred to a new 2 mL Tube (CELLTREAT, catalog number: 229446) and centrifuged at 1,000 g for 5 min ...
-
No products found
because this supplier's products are not listed.
Elisa Maritan, et al.,
bioRxiv - Microbiology 2022
Quote:
... and sputter-coated with 3 nm of platinum (Q150T ES, Quorum Technologies Ltd, Ringmer, UK). Alternatively ...
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...