-
No products found
because this supplier's products are not listed.
Alexandria N. Miller, et al.,
bioRxiv - Biophysics 2022
Quote:
... and 2 µM 9-Amino-6-Chloro-2-Methoxyacridine (ACMA, Sigma-Aldrich) to establish a K+ gradient ...
-
No products found
because this supplier's products are not listed.
Chrysa Kapeni, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
No products found
because this supplier's products are not listed.
Omobukola Solebo, et al.,
bioRxiv - Microbiology 2021
Quote:
... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
No products found
because this supplier's products are not listed.
Graham. M. Pitcher, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-Chloro-4-fluoro-N-[4-[[2-(phenylcarbonyl) hydrazino]carbonyl]benzyl]benzene-sulfonamide (TCN 201, 3 μM dissolved in DMSO; Tocris Bioscience), (αR,βS)-α-(4-Hydroxyphenyl)-β-methyl-4-(phenylmethyl)-1-piperidinepropanol maleate (Ro25-6981 ...
-
No products found
because this supplier's products are not listed.
Samir Jana, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5-bromo-4-chloro-3-indoxylphosphate/nitroblue tetrazolium chloride (BCIP/NBT) substrate (Abcam cat # ab7468).
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
R. Wercberger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2% Fluoro-Gold (Fluorochrome), or the HSV-hEF1a-GFP-L10a.
-
No products found
because this supplier's products are not listed.
Stéphane Koundrioukoff, et al.,
bioRxiv - Genetics 2023
Quote:
... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
No products found
because this supplier's products are not listed.
Hua Tian, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) and coverslips were mounted over slides in Fluoro-Gel (EMS; 17985-10) and imaged by spinning disc confocal microscopy and Aperio Versa 8 fluorescent slide scanner.
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Amanda N.D. Adams, et al.,
bioRxiv - Microbiology 2021
Quote:
... 200µg/ml 5’-fluoro-2’-deoxyuridine (VWR), 100ng/ml anhydrotetracycline (Sigma) ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Mai Takenaka, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... riluzole (supply name: 2-amino-6-(trifluoromethyl)benzothiazole) and 4-chloro-3-ethylphenol (4-CEP) from Tokyo Chemical Industry (Tokyo, Japan), and 4-chloro-m-cresol (4-CMC ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Marinelle Rodrigues, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 gr 4-Chloro-DL-phenylalanine (Alfa Aesar, cat. A13323), 15 gr agar per 1 L of media) ...
-
No products found
because this supplier's products are not listed.
S. ter Horst, et al.,
bioRxiv - Microbiology 2022
Quote:
2’-Fluoro-2’-deoxycytidine (2’-FdC) (Biosynth-Carbosynth) was dissolved in 100% DMSO (VWR Chemicals) ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Tuce Tombaz, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Suzanne M Johnson, et al.,
bioRxiv - Cell Biology 2020
Quote:
EVs were immobilised onto ACLAR (poly-chloro-tri-fluoro-ethylene (PCTFE) film) coated with CellTak (Corning: cat 354240) and fixed with glutaraldehyde in sodium cacodylate buffer (pH 7.2 ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ...
-
No products found
because this supplier's products are not listed.
Melissa Martinez, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Fe (III) mesoporphyrin IX chloride (FeMP) and hemin chloride were from Santa Cruz Biotechnology (Chem Cruz) ...
-
No products found
because this supplier's products are not listed.
Brian J. Thomas, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 2’-fluoro modified CTP and 2’-fluoro modified UTP (TriLink Biotechnologies). All RNA aptamers were purified through denaturing polyacrylamide gel electrophoresis (0.75 mm ...
-
No products found
because this supplier's products are not listed.
Melanie Werner-Klein, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
No products found
because this supplier's products are not listed.
Rajagopal Ayana, et al.,
bioRxiv - Neuroscience 2021
Quote:
... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Yuishin Kosaka, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Sofia E. Luna, et al.,
bioRxiv - Genetics 2024
Quote:
2-3 days post-electroporation HSPCs were plated in SmartDish 6-well plates (cat.: 27370; STEMCELL Technologies, Vancouver, Canada) containing MethoCult H4434 Classic or MethoCult H4434 Classic without EPO (cat. ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Ryan Hull, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Linda Scaramuzza, et al.,
bioRxiv - Neuroscience 2020
Quote:
Intracellular chloride measurements were performed using the N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide (MQAE) (Biotium) chloride sensor.
-
No products found
because this supplier's products are not listed.
Yannick Delpu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... coated coverslips and incubated with 25 µM 5-chloro-2’-deoxyuridine (CldU) (MP Biomedicals 0210547891) (for RPA2 detection ...
-
No products found
because this supplier's products are not listed.
Lea C. Neelsen, et al.,
bioRxiv - Biophysics 2023
Quote:
... (2-(Trimethylammonium)ethyl) MethaneThioSulfonate Chloride (MTS-ET) (Toronto Research Chemicals, USA) was directly dissolved to the desired concentration of 1.0 mM in the intracellular recording solution prior to each experiment ...
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Andrew Shum, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or 23mm well fluoro dishes (World Precision Instruments). The intracellular free calcium concentration ([Ca2+]i ...
-
No products found
because this supplier's products are not listed.
James B. Bower, Scott A. Robson, Joshua J. Ziarek,
bioRxiv - Biophysics 2024
Quote:
... and 2 g L-1 of [15N] ammonium chloride (Cambridge Isotope Laboratories, CIL) as the sole carbon and nitrogen source ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
Cat# HY-W096131,
inquire
Ask
Isadora Oliveira Prata, et al.,
bioRxiv - Microbiology 2021
Quote:
1-(2,3-di(Thiophen-2-yl)quinoxalin-6-yl)-3-(2-methoxyethyl)urea (CAS 508186-14-9 – MCE-MedChemExpress) is an Acetyl-CoA Synthetase 2-specific and potent inhibitor ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 6 (3M and 6M, mIPSCs), respectively.
-
No products found
because this supplier's products are not listed.
Bella Koltun, et al.,
bioRxiv - Neuroscience 2019
Quote:
... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ...
-
No products found
because this supplier's products are not listed.
Robert C. Klipp, John R. Bankston,
bioRxiv - Biophysics 2022
Quote:
... pulled to a resistance of 2–6 MΩ (P-1000; Sutter Instrument) and filled with an internal solution containing (in mM) ...