-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2-axis computer-controlled stepping motor system (4”× 3” XY; Prior Scientific, Jena, Germany), focus encoder (Heidenhain ...
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Caitlin L. Maikawa, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 4-((((2-carboxyethyl)thio)carbonothioyl)thio)-4-cyanopentanoic acid (BM1433; Boron Molecular, >95%) were used as received ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Trevor S. Wendt, Rayna J. Gonzales,
bioRxiv - Physiology 2023
Quote:
... HBMECs at density of 3 to 4 × 105/cm2 were seeded onto glass coverslips coated with attachment factor (Cell Systems; Catalogue number: 4Z0-201) within 6-well plates at passage 7 ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Gaurav Gupta, et al.,
bioRxiv - Immunology 2019
Quote:
... 4% mouse serum (ImmunoReagents) and 4% goat serum ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
Bruno Motta Nascimento, Nikhil Unni Nair,
bioRxiv - Bioengineering 2020
Quote:
... coli were hydrolyzed 6 M HCl at 100 °C for 4 h in a vacuum sealed tube (Chemglass, #CG-4025-01). Acid was immediately removed with a vacuum centrifuge and pellet was resuspended in deionized water ...
-
No products found
because this supplier's products are not listed.
Sophie Girardin, et al.,
bioRxiv - Neuroscience 2021
Quote:
... it was first immersed in a solution of 4 % Tergazyme (Alconox, 1304-1) for 24 h to remove cell culture and proteins ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Clémence Bernard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and (4) literature on interneuron connectivity (MEDLINE search for “gene name” and “synapse” and “interneuron”) ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Mengqi Luo, et al.,
bioRxiv - Biochemistry 2022
Quote:
... overnight at 4 °C and then HRP-conjugated secondary antibody (1:2000, ZEN BIO, China) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Alec W. Stranahan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or Ara-C (LKT Laboratories, cat no: 147-94-4). For combination treatment studies with Zileuton (LKT Laboratories ...
-
No products found
because this supplier's products are not listed.
Mei Hong Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... or 9 U Isopol SD+ (ArcticZymes). Reaction temperatures and times for these polymerases were ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Coelenterazine h (Prolume Ltd., 50909-86-9), GloSensorTM cAMP Assay Reagent (Promega ...
-
No products found
because this supplier's products are not listed.
Michael T. Patterson, et al.,
bioRxiv - Immunology 2023
Quote:
... DiI-oxLDL (Kalen Biomedical, Cat#: #770282-9) was added at 10 μg/ml for 4 hours at 37ºC ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Plates were washed again and incubated for 1h with K2 anti-dsRNA (SCICONS). After another wash ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... IMPACT Mouse FELASA and MKPV testing and was authenticated by CellCheck human 9 Test (9 Marker STR Profile and Inter-species Contamination Test) (IDEXX Analytics, Kornwestheim, Germany). H295R cells stably expressing a doxycycline inducible β-Catenin shRNA (pTer1 shRNA vector ...
-
Cat# H6K243,
USD $495.0/kit
Ask
Akihisa Kato, et al.,
bioRxiv - Microbiology 2023
Quote:
... glycoprotein B (gB) (H1817; Virusys), Flag (M2 ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Matthieu Fritz, et al.,
bioRxiv - Microbiology 2023
Quote:
... and amplicons approximately 2–3 kb in size were excised from the gel and purified using the Quick-spin PCR Product Purification Kit (iNtRON Biotechnology, Korea). The amplicons were further cloned in pJET1.2 cloning plasmid (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Evan C. Lien, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Plasma insulin for CR and KD studies was sampled after a 4 h fast and was measured with an ultra-sensitive mouse insulin ELISA (Crystal Chem #90080).
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Shaohe Wang, Kazue Matsumoto, Kenneth M. Yamada,
bioRxiv - Developmental Biology 2020
Quote:
Spheroids were rinsed in 2 mL PBS in a 35 mm dish and transferred into sample baskets (one basket per staining group; Intavis, 12.440) using low-retention pipette tips (cut for larger opening; Rainin, 30389187 or 30389190) under a dissecting microscope ...
-
No products found
because this supplier's products are not listed.
Cheryl Immethun, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The cultures were loaded into a Greiner CELLSTAR® bio-one sterile 48 well culture plate and covered with a Breathe-Easy® Gas Permeable Sealing Membrane (Diversified Biotech). Cultures were then incubated in the dark at 30°C in ambient air for 72 hours at 275 rpm ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...