-
No products found
because this supplier's products are not listed.
Yusuke Nishimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
Akt1/2/3 inhibitor MK-2206 dihydrochloride (ApexBio, A3010), Rapamycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
David Kim, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... MMP-2/-9 (Novus Biologicals), C3 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Thomas Christiani, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Sections were counterstained with 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) and imaged on a confocal microscope (Model A1+, Nikon Instruments Inc.). Immunofluorescent staining performed on sections without primary ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 6 (3M and 6M, mIPSCs), respectively.
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Bella Koltun, et al.,
bioRxiv - Neuroscience 2019
Quote:
... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Paulina M. Wojnarowicz, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5 and 6 hours after addition of the reagent using a plate reader (Synergy 2, BioTek).
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Xinyu Xie, et al.,
bioRxiv - Immunology 2024
Quote:
... 6-diamidino-2-phenylindole ( DAPI) (Solarbio, C006, China) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
H E Foster, C Ventura Santos, A P Carter,
bioRxiv - Cell Biology 2021
Quote:
... Each grid was placed in a microwell of a 9×2 well dish (Ibidi) and 30 μL of cell suspension was added to the surface ...
-
No products found
because this supplier's products are not listed.
Juhi Singh, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM 2-mercaptoethanol and centrifuged with a 70Ti (Beckman coulter) rotor at 40,000 rpm for 18 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
No products found
because this supplier's products are not listed.
Farwa Sajadi, Jean-Paul Paluzzi,
bioRxiv - Physiology 2024
Quote:
... Tissues/organs were mounted on cover slips with mounting media comprised of DPBS with 50% glycerol containing 4 μg/mL 4’6-diamidino-2-phenylindole dihydrochloride (DAPI) and were visualized on a Zeiss LSM 800 confocal laser microscope (Carl Zeiss, Jena, Germany) and processed with the Zeiss LSM Image Browser software or visualized on a Lumen Dynamics XCiteTM 120Q Nikon fluorescence microscope (Nikon ...
-
No products found
because this supplier's products are not listed.
Marc Sevenich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... average tip radius of 9±2 nm and a resonance frequency of approximately 300 kHz (Olympus OMCL-AC160TS-R3). The images were processed using JPK data processing software (version spm-5.0.84) ...
-
No products found
because this supplier's products are not listed.
Felix Wagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
No products found
because this supplier's products are not listed.
Clara W. Liff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were permeabilized for 2 days and blocked in 6% goat serum (Jackson ImmunoResearch, 005-000-121) for 2 days at 37°C ...
-
No products found
because this supplier's products are not listed.
Felix Michaud, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Data acquisition (filtered at 2–3 kHz and digitized at 10kHz; Digidata 1440, Molecular Devices, CA, USA) was performed using the Multiclamp 700B amplifier and the Clampex 10.9 software (Molecular Devices) ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
... HAPECs (passage 2-6, ScienCell, Carlsbad, CA) were incubated with 0.1 ng/mL interleukin-1 beta (IL-1β) ...
-
No products found
because this supplier's products are not listed.
Hamza A. A. Elati, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2’,3’-dideoxyuridine was from Carbosynth; Pyrimethamine was from Fluka ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Irshad Akbar, et al.,
bioRxiv - Immunology 2023
Quote:
... They were differentiated (9) for 2 days with plate bound anti-CD3 and anti-CD28 (2 μg mL-1 each; BioXcell) into Th1 cells – 10 ng mL-1 rmIL-12 (R&D Biosystems ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
MEISi-2 Dihydrochloride is a potent MEIS inhibitor (MEISi) that significantly inhibits...
Cat# S6062, SKU# S6062-5mg,
5mg, $199.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Andrea Salm, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 2-hydroxy-3-methylanthraquinone (13) and 2-hydroxy-1-methylanthraquinone (14) were obtained from Toronto Research Chemical, ON ...
-
No products found
because this supplier's products are not listed.
Tim Nierhaus, et al.,
bioRxiv - Microbiology 2021
Quote:
... pooled and concentrated to 2-3 mg/ml using Vivaspin 15R concentrators (2 kDa MWCO HY, Sartorius). Small aliquots were flash-frozen in liquid nitrogen and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Ines Heyndrickx, et al.,
bioRxiv - Immunology 2023
Quote:
... treatments were given after mice were anesthetized with isoflurane (2 liters/min, 2 to 3%; Abbott Laboratories).
-
No products found
because this supplier's products are not listed.
Thomas Goralski, et al.,
bioRxiv - Neuroscience 2023
Quote:
... α-Synuclein PFFs were vortexed and diluted with DPBS to 2 mg/mL and sonicated in a cooled bath sonicator at 9°C (Diagenode Bioruptor® Pico ...
-
No products found
because this supplier's products are not listed.
Zhuzhu Zhang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and sorted into 384-well plates preloaded with 2μl of digestion buffer for snmC-seq215 (20 mL digestion buffer consists of 10 mL M-digestion buffer (2×, Zymo D5021-9), 1 ml Proteinase K (20 mg ...
-
No products found
because this supplier's products are not listed.
Esmi Lau Zajaczkowski, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
No products found
because this supplier's products are not listed.
R. Benjamin Free, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 5,6,7,8-tetrahydro-6-[(2-phenylethyl)propylamino]) derivative labeled with a red fluorescent probe (PPHT-red) was obtained from Cisbio Bioassays (Bagnolssur-Cèze ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Mingrong Zuo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... total-JNK1/2/3 (Abclonal #A4867), CCL2/MCP1 (Abclonal # A23288).
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Jana Travnickova, et al.,
bioRxiv - Cell Biology 2019
Quote:
Embryos were soaked in MMP-2 and 9 inhibitors SB-3CT (Enzo Life Sciences) 9 μM or NSC23766 Rac inhibitor (Tocris ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
Yuxuan Zhang, et al.,
bioRxiv - Cell Biology 2021
Quote:
C3H10T1/2 cells (clone 9, passage 18, cells obtained from American Type Culture Collection (ATCC)) were incubated at 37°C with 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Rebecca T. Perelman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... the 3’-end azide functionalization in presence of 2’-azido-2’-deoxyadenosine-5’triphosphate (ATP-azide, Trilink Biotechnologies) using yeast poly(A ...
-
No products found
because this supplier's products are not listed.
Alexey Kolodkin, et al.,
bioRxiv - Systems Biology 2019
Quote:
... PC12 (2×105 cells/well) were plated in 6-well plates (EuroClone) pre-coated with poly-L-lysine (0.1 mg/ml) ...
-
No products found
because this supplier's products are not listed.
Lok Man John Law, et al.,
bioRxiv - Microbiology 2021
Quote:
Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
No products found
because this supplier's products are not listed.
Filippo Ghezzi, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch pipettes were obtained from borosilicate glass microelectrodes (6-9 MΩ; Harvard Apparatus, UK), pulled through a PC-10 puller (Narishige ...
-
No products found
because this supplier's products are not listed.
Yana Blokhina, Abigail Buchwalter,
bioRxiv - Molecular Biology 2023
Quote:
... and selected with 6 μg/mL blasticidin (RPI Research Products, Cat# 3513-03-9). Expression of pXLone-dCas9-DNMT3A3L-P2A-EGFP was induced with 2 μg/mL Doxycycline (VWR ...
-
No products found
because this supplier's products are not listed.
Chase P. Kelley, Maja C. Haerle, Eric T. Wang,
bioRxiv - Molecular Biology 2021
Quote:
... cells were passaged to 12-well tissue culture plates at a density of 1.5×105 cells/well (3.9×104 cells/cm2) and transfected with 500 ng plasmid DNA using 2 uL of TransIT-X2 transfection reagent (Mirus Bio, #MIR6005) and 100 uL Opti-MEM I reduced serum medium (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Gaëlle Hogrel, et al.,
bioRxiv - Biochemistry 2022
Quote:
... These were diluted 2-fold with water and ultracentrifuged using 3 kDa MWCO spin filters (Pall). Liquid chromatography analysis was performed on the Dionex UltiMate 3000 system ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
... INF-2 (GeneTex; CTX130714), SPIRE-1C (custom made ...
-
No products found
because this supplier's products are not listed.
Ranjan Sengupta, et al.,
bioRxiv - Cell Biology 2019
Quote:
Cell pellets (2-3 μl) were loaded onto copper membrane carriers (1mm x 0.5 mm; Ted Pella Inc.) and cryofixed using the EM PACT2 high pressure freezer (Leica) ...