-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Alpha-2-macroglobulin was purchased from Athens Research and was activated by methylamine as described (Ashcom et al. ...
-
No products found
because this supplier's products are not listed.
Cassandra M. Stawicki, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Aliquots of 2-5 µl of sample were added to 700 µl of 2% PBS and loaded into a cuvette (BrandTech Scientific, 759150). Zeta potential was measured in Folded Capillary Cell cuvettes (Malvern ...
-
Cat# IMS206_Giardia-3X,
USD $1980.0/kit
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Cian Schmitt-Ulms, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Cypridina Luciferase Assay reagent (Targeting Systems, VLAR-2) respectively ...
-
No products found
because this supplier's products are not listed.
Lucas Ferguson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... from 6 mL of polysome buffered 10% (w/v) D-sucrose and 6 mL of polysome buffered 50% D-sucrose solution using the Gradient Master (BioComp Instruments). Using a wide-bore pipette tip ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Alessandro Gori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The detector antibody (biotinylated CD9, CD63, CD81 antibodies by Ancell or anti-band 3 from Santa Cruz) solutions (0.3 µg/ml ...
-
No products found
because this supplier's products are not listed.
Yalda Afshar, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Confluent endothelial monolayers were grown on tissue culture treated 6-well plates (Falcon #08-772-1B) in complete MCDB-131 media (VEC Technologies # MCDB131-WOFBS) plus 10% FBS (Omega Scientific #FB-11 ...
-
No products found
because this supplier's products are not listed.
Colin Kremitzki, et al.,
bioRxiv - Genetics 2023
Quote:
Lentiviruses carrying the gRNA libraries were packaged into 8×106 HEK 293T cells/well in a 6-well plate (TPP92006, MIDSCI, Fenton, MO, USA), using the TransIT Lentivirus transfection reagent (MIR 6600 ...
-
No products found
because this supplier's products are not listed.
Adrian T. Press, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1,2-Dipalmitoyl-sn-glycerol-3-phosphoethanolamine (DPPE) azide was conjugated to DY-635-alkin (Dyomics GmbH, Jena, Germany) and used to prepare liposomes using a 100 nm extruder ...
-
No products found
because this supplier's products are not listed.
Paul D. Simonson, Itzel Valencia, Sanjay S. Patel,
bioRxiv - Immunology 2022
Quote:
... we created the following custom-conjugated oligomer (5’ to 3’, custom orders to Gene Link, Elmsford, New York):
-
Cat# IT-52-250,
250 micrograms,USD $2400.0
Ask
Savannah Barnett, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Hcrt-SAP (hypocretin-2-saporin, Advanced Targeting Systems, San Diego, CA, USA). The method of stereotaxic injection was similar to those described in our previous study and will be brief here (Nattie et al. ...
-
No products found
because this supplier's products are not listed.
Marko Roblek, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and LPA-FITC were from EY laboratories (FITC-labeled lectin kit #2), anti-β1 integrin (clone HMb1-1 ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Devon L. Moose, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... The identity of this cell line as a derivative of PC-3 cells was validated by short tandem repeat (STR) analysis (IDEXX). Cells of both the PC-3 and GS689.Li lines were cultured in DMEM/F12 (Gibco ...
-
No products found
because this supplier's products are not listed.
William Finnigan, et al.,
bioRxiv - Bioengineering 2020
Quote:
N-R7-C at 300 mg/mL was extruded using a syringe pump through a pre-pulled glass capillary (MGM-3-1.5-5NF, 30 μm tip, FivePhoton Biochemicals) at 0.5 mL/h using a syringe pump (Cole-Palmer 74900 series ...
-
No products found
because this supplier's products are not listed.
Xingyu Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2.5:0.1,2.5:0.5, 2.5:1, and 2.5:2, 1.5 MDa sodium hyaluronate from Lifecore Biomedical). The gel solutions were incubated at 37°C overnight and were then submerged in deionized water at room temperature ...
-
No products found
because this supplier's products are not listed.
Aleksei Kuznetsov, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and SARS-CoV-2 Spike protein S1 (Icosagen OÜ, Estonia, cat# P-305-100) were used in this study.
-
No products found
because this supplier's products are not listed.
Ortal Iancu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... using combinations of 4 primers for Vγ and 3 primers for Jγ regions in each reaction (IdentiClone™ TCRG Gene Clonality Assay, Invivoscribe, Inc.). TRG clonality was ran and analyzed on 2% agarose gel ...
-
No products found
because this supplier's products are not listed.
S Ghoroghi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 2 ml of concentrated extracellular medium were applied on top of a qEV column (Izon Science) and 6 ml fractions were collected ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
Brandon C. Farmer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... aged 2-4 months (young) and group housed in sterile micro-isolator cages (Lab Products, Maywood, NJ), and fed autoclaved food and acidified water ad libitum ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Takao Fujisawa, et al.,
bioRxiv - Cell Biology 2023
Quote:
Recombinant proteins or ZnCl2 solution for normalization was incubated with 10 µM ZnAF-2 (Goryo Chemical, SK2001-01) in TBS for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Unekwu M. Yakubu, Kevin A. Morano,
bioRxiv - Biochemistry 2021
Quote:
α-synuclein thioflavin T binding assays were performed by incubating 2 μM α-synuclein monomer (StressMarq Biosciences, Victoria, BC, Canada), 1 μM pre-formed fibrils (StressMarq Biosciences ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... whole blood (10 µL) was mixed with 2 mM EDTA (10 µL) and analyzed using the HemaVet 950S (Drew Scientific).
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Eric Esposito, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The RNA was further purified by twice mixing the aqueous supernatant with 700 μL of acidic phenol chloroform and centrifuging the solution in a 5Prime Phase Lock Gel Heavy 2 ml tube (Andwin Scientific) at 16,000 rcf to separate the phases ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Hongbing She, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR was performed in a total reaction volume of 10 μL containing 5 μL 2×Taq Master Mix (CoWin Biosciences, China), 0.25 μL forward and reverse primer ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from each cornea were seeded equally across 2 wells of a 24-well plate coated with fibronectin collagen (FNC) coating mix (Athena Enzyme Systems) in M5 stabilization media (human endothelial SFM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Jordina Rincon-Torroella, et al.,
bioRxiv - Cancer Biology 2023
Quote:
MIA PaCa-2 or Panc 02.13 cells were transduced with a CMV-Firefly luciferase lentivirus carrying a puromycin-selectable marker (Cellomics Tech; Halethorpe, MD, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...