-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Yusong Guo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The BC-1471 compounds (TargetMol, CAS 896683-84-4 and CAS 896683-78-6) were also evaluated with STAMBPJAMM under identical conditions with a final concentration of 1 μM ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1006,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Huan Peng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 4% chlorhexidine (McKesson Corporation) or 2% acetic acid (Akorn Pharmaceuticals) ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Sydney Morrill, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10 µL of washed bacterial samples (∼6×105 CFU) were transferred to a 96-well plate and exposed to 4% pooled normal human serum (NHS) (Complement Technologies) in wash buffer ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Raquel Garza, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4% buffered formalin (Histo-Lab Products AB ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Eman A. Akam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tert-Butyl 3-aminopropoxycarbamate was purchased from AmBeed and used without further purification ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Dennis Schifferl, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... in 4 ml glass vials (Wheaton 224882) and processed as described previously (Schifferl et al 2021) ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Mary V. Arrastia, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... the nuclei concentration was assessed by loading 6 µL of the solution into a disposable hemocytometer (4-Chip Disposable Hemocytometer, Bulldog Bio, #DHC-N420, Portsmouth, NH). After determining nuclei concentration ...
-
No products found
because this supplier's products are not listed.
Liang Qu, et al.,
bioRxiv - Immunology 2022
Quote:
... and NHP IL-4 ELISpot assay kit (U-CyTech). The cryopreserved rhesus macaques PBMCs were thawed and cultured with pre-warmed AIM-V media ...
-
No products found
because this supplier's products are not listed.
Emily L. Pruitt, et al.,
bioRxiv - Microbiology 2023
Quote:
... and C20:4 (Nu-Chek Prep, Inc., Elysian, MN) in ethanol each at 100 μM in TSB ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
No products found
because this supplier's products are not listed.
Stephanie J. Melchor, et al.,
bioRxiv - Immunology 2019
Quote:
... cells were seeded onto fibronectin coated 4 kPa polyacrylamide hydrogels (Matrigen) and stimulated with 10 ng/mL recombinant mouse IL-1α (R&D) ...
-
No products found
because this supplier's products are not listed.
Cerys S Manning, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Western blots were performed using 4-20% Tris-glycine acrylamide gels (NuSep), Whatman Protran nitrocellulose membrane (Sigma ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Ruikang Liu, et al.,
bioRxiv - Microbiology 2021
Quote:
... the wells were washed 3 times with 250 μl of PBS + 0.05% Tween 20 (PBS-T, Accurate Chemical) and plates were blocked with 200 μl PBS-T + 5% Nonfat Dry Milk for 2 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Desirée Böck, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Brain sections were incubated with primary antibodies overnight at 4°C (rabbit-NeuN, 1:1’000, abcam 177487; mouse-TH; 1:1’000, Immunostar 22941 ...
-
No products found
because this supplier's products are not listed.
Albéric A. de Lajarte, et al.,
bioRxiv - Biochemistry 2024
Quote:
... adding a T7 promoter sequence at the forward primer (5′ TAATACGACTCACTATAG 3′) using a 2X PCR PreMix (Syd Labs, Cat. MB067-EQ2N), human cDNA (ZYAGEN ...
-
No products found
because this supplier's products are not listed.
Youwen Zhuang, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cell cultures were grown to a density of 4×106 cells/ mL in ESF 921 serum-free medium (Expression Systems). For the expression of the DRD1-Gs complexes ...
-
No products found
because this supplier's products are not listed.
Elad Lax, et al.,
bioRxiv - Neuroscience 2020
Quote:
... pre-blocked with BSA and incubated overnight at 4°C with an anti-Mbd2 (IP grade, Epigentek-A1007, Burlington, ON) antibody ...
-
No products found
because this supplier's products are not listed.
J.M. Dwulet, et al.,
bioRxiv - Biophysics 2019
Quote:
... from plasma extracted from blood samples centrifuged for 30 minutes at 3000 rpm at 4°C and assayed using mouse ultrasensitive insulin ELISA (Alpco).