-
No products found
because this supplier's products are not listed.
Yiran Wei, et al.,
bioRxiv - Neuroscience 2021
Quote:
All patients underwent maximal safe surgery using 5-aminolevulinic acid fluorescence (5-ALA, Medac, Stirling, UK) and neuro-navigation (StealthStation ...
-
No products found
because this supplier's products are not listed.
Miwa Umebayashi, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Methyl beta cyclodextrin was purchased from CycloLab. Cholesterol-water soluble ...
-
No products found
because this supplier's products are not listed.
Matthew T. Parker, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and the 5′ cap was removed by Cap-Clip Acid Pyrophosphatase (Cambio) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Peter M. Masschelin, et al.,
bioRxiv - Physiology 2022
Quote:
... and serum-free fatty acids (#sfa-1; Zen-Bio).
-
No products found
because this supplier's products are not listed.
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... Hoechst 33342 Fluorescent Nucleic Acid Stain (#639, ImmunoChemistry Technologies, 1:200), goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Rasmus Ree, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Couplings were performed using 3-6 equivalents Fmoc-amino acid/TBTU and 6-12 equivalents N-methylmorpholine on the following resin: Tentagel S Trityl resin (RAPP Polymere, Germany), loading ...
-
No products found
because this supplier's products are not listed.
Jérémie Prévost, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-Luciferin free acid (Prolume). The neutralization half-maximal inhibitory concentration (IC50 ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus wood particles were decomposed with a mixture (20 mL) of acetic acid containing 1% peracetic acid using a microwave reactor (Biotage Initiator Plus) at 50 ...
-
No products found
because this supplier's products are not listed.
Emma Laporte, et al.,
bioRxiv - Developmental Biology 2022
Quote:
WT (C57BL/6) neonatal mice (PD5) were treated twice with 5 μg LGK-974 (Biogems, Westlake Village, CA) per g bodyweight or vehicle (corn oil ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Lydia M Le Page, et al.,
bioRxiv - Immunology 2019
Quote:
... 24μl [1-13C] pyruvate sample (pyruvic acid, 15mM OX63 trityl radical (Oxford Instruments), and 1.5mM Gad-DOTA ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 0.5 μg of AMAC-conjugated disaccharide samples and standard disaccharides (hyaluronic acid – HA, non-sulfated chondroitin - C0S, C4S, C6S; Seikagaku) were separated on a 30% polyacrylamide gel in Tris Glycine buffer for 30-40 min.
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... version 6 (DNAStar). Consensus sequences were derived from at least two independent forward and reverse sequences ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Siranush Babakhanova, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Two-photon spectrum and cross sections of TagRFP658 were measured in PBS buffer at concentrations ∼1–5·10−5 M in 1 mm glass spectroscopy cuvettes (Starna cells) using an MOM two-photon fluorescent microscope (Sutter Instrument ...
-
Glucose-6-Phosphate Dehydrogenase Kit
Cat# DGPDH-100,
1.0 kit, 100 tests, USD $339.0
Ask
Kaori Kobayashi, et al.,
bioRxiv - Immunology 2021
Quote:
The concentrations of total sialic acid (TSA) and free sialic acid (FSA) in saliva were measured using a sialic acid assay kit (Bioassay Systems). The concentration of protein-bound sialic acid (BSA ...
-
No products found
because this supplier's products are not listed.
Terje Wimberger, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Adaptors to the flow system (NanoPort Std 6-32 Coned 1/32, IDEX, USA) were fixed to in- and outlets ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Telmo A. Catarino, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... or LPS (1:100, WN1 222-5, Hycult Biotech) at 4 ° C ...
-
No products found
because this supplier's products are not listed.
Natasha M. O’Brown, Sean G. Megason, Chenghua Gu,
bioRxiv - Developmental Biology 2019
Quote:
... 2.3 nl of 5 nm NHS-activated gold nanoparticles (Cytodiagnostics: CGN5K-5-1, ∼1.114 particles/ml in PBS) were injected into the cardiac sac just as for the fluorescently conjugated tracers ...
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...
-
No products found
because this supplier's products are not listed.
Miloslav Sanda, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Fmoc-amino acids were purchased from ChemPep, Inc ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... BMAL1 (1:1000 in 5% BSA and TBST, Signalway Antibody, LLC, #21415,), GSK3β (3D10 ...
-
No products found
because this supplier's products are not listed.
Megan E. Patton, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Calorimetric measurement of serum and hepatic bile acids was performed with the Total Bile Acid (NBT method) kit (Genway Biotech).
-
No products found
because this supplier's products are not listed.
Shikai Hu, et al.,
bioRxiv - Pathology 2021
Quote:
Total hepatic bile acids were measured using the Mouse Total Bile Acids Assay Kit from Crystal Chem (Downers Grove, IL), as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Samantha Mar, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... The spheroids were transferred into 500 μL acid ethanol (1 M HCl in 70% ethanol) for either human C-peptide ELISA (Alpco) or human glucagon ELISA (Mercodia).
-
Cat# F6,
USD $18.00/EA
Ask
Taylor Anthony Stevens, et al.,
bioRxiv - Biochemistry 2023
Quote:
dPEG24-biotin acid (Quanta Biodesign, USA; cat. no. 10773)
-
No products found
because this supplier's products are not listed.
Yan Liu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... adult mice were immunized by intradermal injection of 100 µg of bovine type II collagen that was emulsified in 100 µl of emulsion containing 50 µl acetic acid (0.01 M) and 50 µl CFA (1 mg/ml Myobacterium tuberculosis; Chondrex Inc, Woodinville, WA) at the base of the tail ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Ekaterina Kropocheva, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5% glycerol) supplemented with 1 mM of PMSF and disrupted using Cell Disruptor CF (Constant Systems). The lysate was cleared by centrifugation ...
-
No products found
because this supplier's products are not listed.
Junying Zheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... in 6 ml hibernate without calcium (BrainBits, cat. no. HACA) with 15 μl 0.5mM Glutamax ...
-
No products found
because this supplier's products are not listed.
Karli A. Lipinski, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 200 µL 425-600 micron acid-washed glass beads (Scientific Industries) and 300 µL 1:1 phenol/CHCl3 were added and cells were lysed by vortexing twice at high speed for 1 min with a 1 min rest on ice between ...
-
No products found
because this supplier's products are not listed.
Johanna F. Dekkers, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 μM Y-27632 (Abmole), 5 nM Heregulin β-1 (Peprotech) ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 ng/mL insulin (CELL technologies), 25 ng/mL hydrocortisone (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Iosifina P. Foskolou, et al.,
bioRxiv - Immunology 2022
Quote:
... Eu-Protein A (5 nM, Cisbio), Streptavidin-Alexa Fluor 647 (6.25 nM ...
-
No products found
because this supplier's products are not listed.
Zhaofa Wu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... adult (>6 weeks of age) mice were anesthetized either with isoflurane (RWD Life Science) inhalation or Avetin (500 mg/kg ...
-
No products found
because this supplier's products are not listed.
Isabella M. Fuentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mice were singly confined to a sheet of filter paper (11 × 5 × 3.5 cm) for 1 hour using an inverted Micro-Isolator cage bottom (Lab Products, Seaford, DE). At the end of the testing period ...
-
No products found
because this supplier's products are not listed.
MI Oliveira da Silva, et al.,
bioRxiv - Neuroscience 2021
Quote:
... in TBS-T or 5%BSA (NZYTech) in TBS-T for 1 h at RT ...
-
No products found
because this supplier's products are not listed.
G. Scott, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... nucleic acid extracts were cleaned with Mag-Bind® TotalPure NGS beads (Omega Bio-Tek, USA) following Child et al. ...
-
No products found
because this supplier's products are not listed.
Matthew Gemberling, et al.,
bioRxiv - Genomics 2021
Quote:
... 1° Antibodies were incubated in 5% milk in TBS-T and used at the following manner: Anti-Cas9 (EnCor Biotechnology/Cat#MCA-3F)-1:2000 at room temp for 2-3 hours ...
-
No products found
because this supplier's products are not listed.
Shuai Qi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5 ul 2×Taq PCR mix (TIANGEN, China), 0.5 ul each primer (trnL and trnF (Taberlet et al. ...
-
No products found
Mohummad Aminur Rahman, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Yu-Heng Tseng, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were saturated with 5% milk powder in PBS with 0,05% Tween-20 (PBS-T) followed by immunostaining with anti-GFP antibodies (Torrey Pines Biolabs, 1:5000 in PBS-T) and secondary goat-anti-rabbit antibodies coupled to alkaline phosphatase (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Shouka Parvin Nejad, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The insoluble elastin content of oxalic acid digested samples was measured using the FastinTM Elastin Assay Kit by Biocolor (Accurate Chemical and Scientific Corporation ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and mCherry (ThermoFisher #PA534974 at 1:1000; Invitrogen #M11217 at 1:500; PhosphoSolutions #1203-mCherry at 1:10,000). Multiple PDE11A antibodies were utilized to discern the ectopic accumulation of PDE11A4 in ghost axons ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).